SARS-CoV-2 is a new corona virus responsible for the pandemic named Coronavirus Disease 2019 (COVID-19). The disease causes severe acute respiratory syndromes with a significant morbidity and mortality.
We provide a review with a focus on COVID-19 in dermatology. We discuss triage of suspected infectious patients, protection of medical doctors and nurses. We discuss the available data on cutaneous symptoms, although disease-specific symptoms have yet not been observed. COVID-19 is a challenge for the treatment of dermatologic patients, either with severe inflammatory disorders or with skin cancer.
Human Coagulation Factor VIII (F8) ELISA Kit |
DLR-F8-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma. |
Human Coagulation Factor VIII (F8) ELISA Kit |
DLR-F8-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma. |
Mouse Coagulation Factor VIII (F8) ELISA Kit |
DLR-F8-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma. |
Mouse Coagulation Factor VIII (F8) ELISA Kit |
DLR-F8-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma. |
Canine Coagulation Factor VIII (F8) ELISA Kit |
RDR-F8-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Canine Coagulation Factor VIII (F8) ELISA Kit |
RDR-F8-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Coagulation Factor VIII (F8) ELISA Kit |
RDR-F8-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Coagulation Factor VIII (F8) ELISA Kit |
RDR-F8-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Coagulation Factor VIII (F8) ELISA Kit |
RDR-F8-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Coagulation Factor VIII (F8) ELISA Kit |
RDR-F8-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Canine Coagulation Factor VIII (F8) ELISA Kit |
RD-F8-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Canine Coagulation Factor VIII (F8) ELISA Kit |
RD-F8-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Coagulation Factor VIII (F8) ELISA Kit |
RD-F8-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Coagulation Factor VIII (F8) ELISA Kit |
RD-F8-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Coagulation Factor VIII (F8) ELISA Kit |
RD-F8-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Coagulation Factor VIII (F8) ELISA Kit |
RD-F8-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
F8 antibody |
38232-100ul |
SAB |
100ul |
EUR 252 |
F8 Antibody |
1-CSB-PA002462 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against F8. Recognizes F8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
F8 antibody |
70R-9971 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal F8 antibody |
F8 Antibody |
1-CSB-PA007932GA01HU |
Cusabio |
|
|
- Form: liquid
- Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF |
F8 Antibody |
1-CSB-PA007932LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
F8 siRNA |
20-abx915892 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
F8 siRNA |
20-abx915893 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
F8 Blocking Peptide |
33R-3569 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of F8 antibody, catalog no. 70R-9971 |
F8 Conjugated Antibody |
C38232 |
SAB |
100ul |
EUR 397 |
F8 cloning plasmid |
CSB-CL007932HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 651
- Sequence: atgcggatccaagaccctgggaaggtcttctttggcaatgtggattcatctgggataaaacacaatatttttaaccctccaattattgctcgatacatccgtttgcacccaactcattatagcattcgcagcactcttcgcatggagttgatgggctgtgatttaaatagttgcag
- Show more
|
Description: A cloning plasmid for the F8 gene. |
F8 Polyclonal Antibody |
A62534 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
anti-F8 (5E9B2) |
LF-MA30229 |
Abfrontier |
100 ul |
EUR 486 |
Description: Mouse Monoclonal to F8 |
Anti-F8 antibody |
STJ23600 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. |
Factor VIII (F8) Antibody |
20-abx009278 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Factor VIII (F8) Antibody |
abx022383-1ml |
Abbexa |
1 ml |
EUR 878 |
- Shipped within 5-10 working days.
|
Factor VIII (F8) Antibody |
abx022384-02mg |
Abbexa |
0.2 mg |
EUR 676 |
- Shipped within 5-10 working days.
|
F8 Antibody, HRP conjugated |
1-CSB-PA007932LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
F8 Antibody, FITC conjugated |
1-CSB-PA007932LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
F8 Antibody, Biotin conjugated |
1-CSB-PA007932LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse F8 shRNA Plasmid |
20-abx970267 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human F8 shRNA Plasmid |
20-abx951499 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-BMP7 (M1-F8) |
YF-MA10098 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BMP7 |
Anti-GRLF1 (4D4-F8) |
YF-MA13331 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GRLF1 |
EasyComp Fluorescent Particles |
ECFP-F8 |
Spherotech |
mL |
EUR 182 |
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone. |
Monoclonal ACTA1 / ASMA Antibody (clone 5C5.F8.C7), Clone: 5C5.F8.C7 |
AMM01963G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human ACTA1 / ASMA (clone 5C5.F8.C7). The antibodies are raised in Mouse and are from clone 5C5.F8.C7. This antibody is applicable in IHC-P, IF |
Coagulation Factor VIII (F8) Antibody |
abx015745-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx175915 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx102111 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx102112 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx102113 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx102114 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx102115 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx111706 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx171812 |
Abbexa |
|
|
|
Coagulation Factor VIII (F8) Antibody |
20-abx171813 |
Abbexa |
|
|
|
Coagulation Factor VIII (F8) Protein |
abx263579-1000IU |
Abbexa |
1000 IU |
EUR 5311 |
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Protein |
abx263579-250IU |
Abbexa |
250 IU |
EUR 1790 |
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Protein |
abx263579-500IU |
Abbexa |
500 IU |
EUR 3168 |
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx325763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Antibody |
20-abx301929 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal F8 Antibody, Clone: 5E9B2 |
AMM04467G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human F8. The antibodies are raised in Mouse and are from clone 5E9B2. This antibody is applicable in WB, E |
F8 Polyclonal Antibody, HRP Conjugated |
A62535 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
F8 Polyclonal Antibody, FITC Conjugated |
A62536 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
F8 Polyclonal Antibody, Biotin Conjugated |
A62537 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Coagulation Factor VIII (F8) Antibody |
20-abx001205 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Anti-Factor VIII/F8 Antibody |
PA2061 |
BosterBio |
100ug/vial |
EUR 294 |
F8 ORF Vector (Rat) (pORF) |
ORF066737 |
ABM |
1.0 ug DNA |
EUR 2457 |
F8 ORF Vector (Human) (pORF) |
ORF003713 |
ABM |
1.0 ug DNA |
EUR 95 |
F8 ORF Vector (Mouse) (pORF) |
ORF044219 |
ABM |
1.0 ug DNA |
EUR 2522 |
F8 ORF Vector (Mouse) (pORF) |
ORF044220 |
ABM |
1.0 ug DNA |
EUR 2445 |
F8 ORF Vector (Mouse) (pORF) |
ORF044221 |
ABM |
1.0 ug DNA |
EUR 2447 |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Bo01 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: G5E5W1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 39.4kDa
- Isoelectric Point: 9.9
|
Description: Recombinant Bovine Coagulation Factor VIII expressed in: E.coli |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Ca01 |
Cloud-Clone |
-
EUR 528.29
-
EUR 244.00
-
EUR 1706.08
-
EUR 635.36
-
EUR 1170.72
-
EUR 416.00
-
EUR 4115.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O18806
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 18.2kDa
- Isoelectric Point: 10.1
|
Description: Recombinant Dog Coagulation Factor VIII expressed in: E.coli |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Ga01 |
Cloud-Clone |
-
EUR 386.72
-
EUR 206.00
-
EUR 1175.20
-
EUR 458.40
-
EUR 816.80
-
EUR 322.00
-
EUR 2788.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: F1NPT2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.7kDa
- Isoelectric Point: 9.6
|
Description: Recombinant Chicken Coagulation Factor VIII expressed in: E.coli |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Hu01 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P00451
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.2kDa
- Isoelectric Point: 6.8
|
Description: Recombinant Human Coagulation Factor VIII expressed in: E.coli |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Hu02 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P00451
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.8kDa
- Isoelectric Point: 6.4
|
Description: Recombinant Human Coagulation Factor VIII expressed in: E.coli |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Mu01 |
Cloud-Clone |
-
EUR 492.45
-
EUR 235.00
-
EUR 1571.68
-
EUR 590.56
-
EUR 1081.12
-
EUR 392.00
-
EUR 3779.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q06194
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 18.1kDa
- Isoelectric Point: 7.9
|
Description: Recombinant Mouse Coagulation Factor VIII expressed in: Prokaryotic expression |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Po01 |
Cloud-Clone |
-
EUR 537.25
-
EUR 247.00
-
EUR 1739.68
-
EUR 646.56
-
EUR 1193.12
-
EUR 422.00
-
EUR 4199.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P12263
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.5kDa
- Isoelectric Point: 6.4
|
Description: Recombinant Pig Coagulation Factor VIII expressed in: E.coli |
Recombinant Coagulation Factor VIII (F8) |
4-RPB878Rb01 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: B7NZR5
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.7kDa
- Isoelectric Point: 9.7
|
Description: Recombinant Rabbit Coagulation Factor VIII expressed in: E.coli |
F8 ELISA Kit (Human) (OKAN05159) |
OKAN05159 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL |
F8 ELISA Kit (Mouse) (OKAN05926) |
OKAN05926 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.44 pg/mL |
F8 ELISA Kit (Dog) (OKCD02532) |
OKCD02532 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: Factor VIII, along with calcium and phospholipid, acts as a cofactor for factor IXa when it converts factor X to the activated form, factor Xa. ;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28 pg/mL. |
F8 ELISA Kit (Mouse) (OKCD02533) |
OKCD02533 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Factor VIII, along with calcium and phospholipid, acts as a cofactor for factor IXa when it converts factor X to the activated form, factor Xa. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.64 pg/mL |
F8 ELISA Kit (Human) (OKCD07761) |
OKCD07761 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 30pg/mL |
F8 ELISA Kit (Mouse) (OKEH06961) |
OKEH06961 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Factor VIII, along with calcium and phospholipid, acts as a cofactor for factor IXa when it converts factor X to the activated form, factor Xa. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
F8 ELISA Kit (Dog) (OKEH07495) |
OKEH07495 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28pg/mL |
F8 ELISA Kit (Rat) (OKEI00900) |
OKEI00900 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.688 pg/mL |
F8 ELISA Kit (Rat) (OKWB00358) |
OKWB00358 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 4.7 pg/mL |
F8 ELISA Kit (Pig) (OKEH03877) |
OKEH03877 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Factor VIII, along with calcium and phospholipid, acts as a cofactor for factor IXa when it converts factor X to the activated form, factor Xa.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.48 ng/mL |
Anti-RAD9A Antibody (3A3-A7-F8) |
A1316-100 |
Biovision |
|
EUR 338 |
Polyclonal F8 antibody - C-terminal region |
APR01421G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human F8 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal F8 / FVIII / Factor VIII Antibody |
APS00014G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Sheep that recognizes and binds to Human F8 / FVIII / Factor VIII . This antibody is tested and proven to work in the following applications: |
Human Coagulation Factor VIII (F8) Protein |
20-abx166399 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Coagulation Factor VIII (F8) Protein |
20-abx065978 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Coagulation Factor VIII (F8) Protein |
20-abx065979 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dog Coagulation Factor VIII (F8) Protein |
20-abx065980 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2291.00
-
EUR 871.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Pig Coagulation Factor VIII (F8) Protein |
20-abx065981 |
Abbexa |
-
EUR 746.00
-
EUR 300.00
-
EUR 2346.00
-
EUR 899.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody (FITC) |
20-abx271108 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Coagulation Factor VIII (F8) Antibody (FITC) |
20-abx271186 |
Abbexa |
-
EUR 523.00
-
EUR 258.00
-
EUR 1581.00
-
EUR 732.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Coagulation Factor VIII (F8) Antibody (Biotin) |
20-abx271374 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody (Biotin) |
20-abx271452 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1469.00
-
EUR 690.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody (Biotin) |
20-abx272205 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1261.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Coagulation Factor VIII (F8) Antibody (FITC) |
20-abx273671 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Coagulation Factor VIII (F8) Antibody (FITC) |
20-abx274489 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody (Biotin) |
20-abx274552 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1247.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Coagulation Factor VIII (F8) Antibody (HRP) |
20-abx303799 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Antibody (FITC) |
20-abx303800 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Coagulation Factor VIII (F8) Antibody (Biotin) |
20-abx303801 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal F8 / FVIII / Factor VIII Antibody |
AMM01814G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human F8 / FVIII / Factor VIII. The antibodies are raised in Mouse. This antibody is applicable in IHC-P |
F8 sgRNA CRISPR Lentivector set (Human) |
K0707001 |
ABM |
3 x 1.0 ug |
EUR 339 |
F8 sgRNA CRISPR Lentivector set (Rat) |
K7197701 |
ABM |
3 x 1.0 ug |
EUR 339 |
F8 sgRNA CRISPR Lentivector set (Mouse) |
K3845501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Anti-KAP1/TIF1? Antibody (4E1-D12-F8) |
A1312-100 |
Biovision |
|
EUR 338 |
CLIA kit for Human F8 (Coagulation Factor ?) |
E-CL-H0600 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's F8 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human F8 . Standards or samples are added to the micro CLIA plate wells and combined with the spec
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human F8 (Coagulation Factor ?) in samples from Serum, Plasma, Cell supernatant |
CLIA kit for Mouse F8 (Coagulation Factor ?) |
E-CL-M0206 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's F8 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse F8 . Standards or samples are added to the micro CLIA plate wells and combined with the spec
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Mouse F8 (Coagulation Factor ?) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human F8 (Coagulation Factor ?) |
E-EL-H3641 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 377 |
- Gentaur's F8 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human F8. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human F8 (Coagulation Factor ?) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Mouse F8 (Coagulation Factor ?) |
E-EL-M0307 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's F8 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse F8. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse F8 (Coagulation Factor ?) in samples from Serum, Plasma, Cell supernatant |
The consequences for systemic treatment are obvious but it will be most important to collect the clinical data for a better decision process. Last but not least education in dermatology for students will be temporarily not be possible in the classical settings. COVID-19, although not a skin disease by itself has an immense impact on dermatology. This article is protected by copyright. All rights reserved.