Challenges of Covid-19 Pandemic for Dermatology.

SARS-CoV-2 is a new corona virus responsible for the pandemic named Coronavirus Disease 2019 (COVID-19). The disease causes severe acute respiratory syndromes with a significant morbidity and mortality.

We provide a review with a focus on COVID-19 in dermatology. We discuss triage of suspected infectious patients, protection of medical doctors and nurses. We discuss the available data on cutaneous symptoms, although disease-specific symptoms have yet not been observed. COVID-19 is a challenge for the treatment of dermatologic patients, either with severe inflammatory disorders or with skin cancer.

Human Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Hu-48T 48T
EUR 498
  • Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma.

Human Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Hu-96T 96T
EUR 647
  • Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma.

Mouse Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Mu-48T 48T
EUR 508
  • Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma.

Mouse Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Mu-96T 96T
EUR 661
  • Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma.

Canine Coagulation Factor VIII (F8) ELISA Kit

DL-F8-c-192 1 kit of 192 tests
EUR 1237
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Coagulation Factor VIII (F8)

Canine Coagulation Factor VIII (F8) ELISA Kit

DL-F8-c-48 1 kit of 48 tests
EUR 512
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Coagulation Factor VIII (F8)

Canine Coagulation Factor VIII (F8) ELISA Kit

DL-F8-c-96 1 kit of 96 tests
EUR 688
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Hu-192 1 kit of 192 tests
EUR 1103
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Hu-48 1 kit of 48 tests
EUR 465
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Hu-96 1 kit of 96 tests
EUR 621
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Mu-192 1 kit of 192 tests
EUR 1130
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Mu-48 1 kit of 48 tests
EUR 474
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Mu-96 1 kit of 96 tests
EUR 635
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Canine Coagulation Factor VIII (F8) ELISA Kit

RD-F8-c-48Tests 48 Tests
EUR 557

Canine Coagulation Factor VIII (F8) ELISA Kit

RD-F8-c-96Tests 96 Tests
EUR 775

Human Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Hu-48Tests 48 Tests
EUR 500

Human Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Hu-96Tests 96 Tests
EUR 692

Mouse Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Mu-48Tests 48 Tests
EUR 511

Mouse Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Mu-96Tests 96 Tests
EUR 709

Canine Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-c-48Tests 48 Tests
EUR 583

Canine Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-c-96Tests 96 Tests
EUR 811

Human Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Hu-48Tests 48 Tests
EUR 522

Human Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Hu-96Tests 96 Tests
EUR 724

Mouse Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Mu-48Tests 48 Tests
EUR 534

Mouse Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Mu-96Tests 96 Tests
EUR 742

F8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against F8. Recognizes F8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

F8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: liquid
  • Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity Purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF

F8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

F8 antibody

38232-100ul 100ul
EUR 252

F8 antibody

70R-9971 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal F8 antibody

F8 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F8 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F8 Antibody

ABD6397 100 ug
EUR 438

pCDNA4- F8

PVT10395 2 ug
EUR 405

pENTR223- F8

PVT11401 2 ug
EUR 273

F8 Conjugated Antibody

C38232 100ul
EUR 397

F8 cloning plasmid

CSB-CL007932HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atgcggatccaagaccctgggaaggtcttctttggcaatgtggattcatctgggataaaacacaatatttttaaccctccaattattgctcgatacatccgtttgcacccaactcattatagcattcgcagcactcttcgcatggagttgatgggctgtgatttaaatagttgcag
  • Show more
Description: A cloning plasmid for the F8 gene.

F8 Blocking Peptide

33R-3569 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of F8 antibody, catalog no. 70R-9971

F8 Polyclonal Antibody

A62534 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti-F8 (5E9B2)

LF-MA30229 100 ul
EUR 486
Description: Mouse Monoclonal to F8

Anti-F8 antibody

STJ23600 100 µl
EUR 277
Description: This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder.

F8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

F8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

F8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Factor VIII (F8) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Factor VIII (F8) Antibody

abx022383-1ml 1 ml
EUR 878
  • Shipped within 5-10 working days.

Factor VIII (F8) Antibody

abx022384-02mg 0.2 mg
EUR 676
  • Shipped within 5-10 working days.

Mouse F8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human F8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human F8 ELISA Kit

ELA-E0841h 96 Tests
EUR 824


EF001353 96 Tests
EUR 689


ELI-02861d 96 Tests
EUR 928


PVT13357 2 ug
EUR 599

Anti-GRLF1 (4D4-F8)

YF-MA13331 100 ug
EUR 363
Description: Mouse monoclonal to GRLF1

Anti-BMP7 (M1-F8)

YF-MA10098 100 ug
EUR 363
Description: Mouse monoclonal to BMP7

EasyComp Fluorescent Particles

EUR 182
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

Monoclonal ACTA1 / ASMA Antibody (clone 5C5.F8.C7), Clone: 5C5.F8.C7

AMM01963G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human ACTA1 / ASMA (clone 5C5.F8.C7). The antibodies are raised in Mouse and are from clone 5C5.F8.C7. This antibody is applicable in IHC-P, IF

Coagulation Factor VIII (F8) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 996.00
  • EUR 551.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal F8 Antibody, Clone: 5E9B2

AMM04467G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human F8. The antibodies are raised in Mouse and are from clone 5E9B2. This antibody is applicable in WB, E

F8 Polyclonal Antibody, HRP Conjugated

A62535 100 µg
EUR 570.55
Description: fast delivery possible

F8 Polyclonal Antibody, FITC Conjugated

A62536 100 µg
EUR 570.55
Description: reagents widely cited

F8 Polyclonal Antibody, Biotin Conjugated

A62537 100 µg
EUR 570.55
Description: Ask the seller for details

Coagulation Factor VIII (F8) Antibody

abx015745-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Protein

abx263579-1000IU 1000 IU
EUR 5311
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Protein

abx263579-250IU 250 IU
EUR 1790
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Protein

abx263579-500IU 500 IU
EUR 3168
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Coagulation Factor VIII (F8) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

F8 ORF Vector (Human) (pORF)

ORF003713 1.0 ug DNA
EUR 95

F8 ORF Vector (Rat) (pORF)

ORF066737 1.0 ug DNA
EUR 2457

F8 ORF Vector (Mouse) (pORF)

ORF044219 1.0 ug DNA
EUR 2522

F8 ORF Vector (Mouse) (pORF)

ORF044220 1.0 ug DNA
EUR 2445

F8 ORF Vector (Mouse) (pORF)

ORF044221 1.0 ug DNA
EUR 2447

Anti-Factor VIII/F8 Antibody

PA2061 100ug/vial
EUR 294

Recombinant Coagulation Factor VIII (F8)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: G5E5W1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.4kDa
  • Isoelectric Point: 9.9
Description: Recombinant Bovine Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)

  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O18806
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.2kDa
  • Isoelectric Point: 10.1
Description: Recombinant Dog Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)

  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F1NPT2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.7kDa
  • Isoelectric Point: 9.6
Description: Recombinant Chicken Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P00451
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.2kDa
  • Isoelectric Point: 6.8
Description: Recombinant Human Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P00451
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.8kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)

  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q06194
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.1kDa
  • Isoelectric Point: 7.9
Description: Recombinant Mouse Coagulation Factor VIII expressed in: Prokaryotic expression

Recombinant Coagulation Factor VIII (F8)

  • EUR 537.25
  • EUR 247.00
  • EUR 1739.68
  • EUR 646.56
  • EUR 1193.12
  • EUR 422.00
  • EUR 4199.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12263
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.5kDa
  • Isoelectric Point: 6.4
Description: Recombinant Pig Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B7NZR5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: 9.7
Description: Recombinant Rabbit Coagulation Factor VIII expressed in: E.coli

Human Coagulation Factor VIII (F8) Protein

  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Coagulation Factor VIII (F8) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Coagulation Factor VIII (F8) Protein

  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dog Coagulation Factor VIII (F8) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Pig Coagulation Factor VIII (F8) Protein

  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Polyclonal F8 / FVIII / Factor VIII Antibody

APS00014G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Sheep that recognizes and binds to Human F8 / FVIII / Factor VIII . This antibody is tested and proven to work in the following applications:

Polyclonal F8 antibody - C-terminal region

APR01421G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human F8 - C-terminal region. This antibody is tested and proven to work in the following applications:

Monoclonal F8 / FVIII / Factor VIII Antibody

AMM01814G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human F8 / FVIII / Factor VIII. The antibodies are raised in Mouse. This antibody is applicable in IHC-P

Coagulation Factor VIII (F8) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Coagulation Factor VIII (F8) Antibody (FITC)

  • EUR 523.00
  • EUR 258.00
  • EUR 1581.00
  • EUR 732.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)

  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Coagulation Factor VIII (F8) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1247.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Anti-RAD9A Antibody (3A3-A7-F8)

EUR 338

F8 sgRNA CRISPR Lentivector set (Rat)

K7197701 3 x 1.0 ug
EUR 339

F8 sgRNA CRISPR Lentivector set (Mouse)

K3845501 3 x 1.0 ug
EUR 339

F8 sgRNA CRISPR Lentivector set (Human)

K0707001 3 x 1.0 ug
EUR 339

Mouse Coagulation Factor VIII (F8) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Coagulation Factor VIII (F8) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Coagulation Factor VIII (F8) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Anti-EDA (clone F8)-SS-DM1 ADC

ADC-W-399 1mg Ask for price
Description: This ADC product is comprised of an anti-EDA monoclonal antibody (clone F8) conjugated via a linker to a DM1

Monoclonal F8 Antibody (monoclonal) (M03), Clone: 1E9

AMM03510G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human F8 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1E9. This antibody is applicable in E

Dog Coagulation factor VIII(F8) ELISA kit

CSB-EL007932DO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Dog Coagulation factor VIII (F8) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

The consequences for systemic treatment are obvious but it will be most important to collect the clinical data for a better decision process. Last but not least education in dermatology for students will be temporarily not be possible in the classical settings. COVID-19, although not a skin disease by itself has an immense impact on dermatology. This article is protected by copyright. All rights reserved.