Challenges of Covid-19 Pandemic for Dermatology.

SARS-CoV-2 is a new corona virus responsible for the pandemic named Coronavirus Disease 2019 (COVID-19). The disease causes severe acute respiratory syndromes with a significant morbidity and mortality.

We provide a review with a focus on COVID-19 in dermatology. We discuss triage of suspected infectious patients, protection of medical doctors and nurses. We discuss the available data on cutaneous symptoms, although disease-specific symptoms have yet not been observed. COVID-19 is a challenge for the treatment of dermatologic patients, either with severe inflammatory disorders or with skin cancer.

Canine Coagulation Factor VIII (F8) ELISA Kit
DL-F8-c-96	DLdevelop	1 kit of 96 tests	EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit
DL-F8-Hu-192	DLdevelop	1 kit of 192 tests	EUR 1103.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit
DL-F8-Hu-48	DLdevelop	1 kit of 48 tests	EUR 465.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit
DL-F8-Hu-96	DLdevelop	1 kit of 96 tests	EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit
DL-F8-Mu-192	DLdevelop	1 kit of 192 tests	EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit
DL-F8-Mu-48	DLdevelop	1 kit of 48 tests	EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit
DL-F8-Mu-96	DLdevelop	1 kit of 96 tests	EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Canine Coagulation Factor VIII (F8) ELISA Kit
DLR-F8-c-48T	DL Develop	48T	EUR 549.00
Should the Canine Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Coagulation Factor VIII (F8) in samples from plasma or other biological fluids.

Canine Coagulation Factor VIII (F8) ELISA Kit
DLR-F8-c-96T	DL Develop	96T	EUR 718.00
Should the Canine Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Coagulation Factor VIII (F8) in samples from plasma or other biological fluids.

Human Coagulation Factor VIII (F8) ELISA Kit
DLR-F8-Hu-48T	DL Develop	48T	EUR 498.00
Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma.

Human Coagulation Factor VIII (F8) ELISA Kit
DLR-F8-Hu-96T	DL Develop	96T	EUR 647.00
Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma.

Mouse Coagulation Factor VIII (F8) ELISA Kit
DLR-F8-Mu-48T	DL Develop	48T	EUR 508.00
Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma.

Mouse Coagulation Factor VIII (F8) ELISA Kit
DLR-F8-Mu-96T	DL Develop	96T	EUR 661.00
Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma.

Canine Coagulation Factor VIII (F8) ELISA Kit
RD-F8-c-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Canine Coagulation Factor VIII (F8) ELISA Kit
RD-F8-c-96Tests	Reddot Biotech	96 Tests	EUR 775.00

Human Coagulation Factor VIII (F8) ELISA Kit
RD-F8-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500.00

Human Coagulation Factor VIII (F8) ELISA Kit
RD-F8-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692.00

Mouse Coagulation Factor VIII (F8) ELISA Kit
RD-F8-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511.00

Mouse Coagulation Factor VIII (F8) ELISA Kit
RD-F8-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709.00

Canine Coagulation Factor VIII (F8) ELISA Kit
RDR-F8-c-48Tests	Reddot Biotech	48 Tests	EUR 583.00

Canine Coagulation Factor VIII (F8) ELISA Kit
RDR-F8-c-96Tests	Reddot Biotech	96 Tests	EUR 811.00

Human Coagulation Factor VIII (F8) ELISA Kit
RDR-F8-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522.00

Human Coagulation Factor VIII (F8) ELISA Kit
RDR-F8-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724.00

Mouse Coagulation Factor VIII (F8) ELISA Kit
RDR-F8-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534.00

Mouse Coagulation Factor VIII (F8) ELISA Kit
RDR-F8-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742.00

F8 Antibody
1-CSB-PA007932GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: liquid Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity Purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF

F8 Antibody
1-CSB-PA007932LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

F8 antibody
38232-100ul	SAB	100ul	EUR 252.00

F8 antibody
70R-9971	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal F8 antibody

F8 Antibody
ABD6397	Lifescience Market	100 ug	EUR 438.00

F8 siRNA
20-abx915892	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

F8 siRNA
20-abx915893	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

F8 Antibody
1-CSB-PA002462	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against F8. Recognizes F8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

pCDNA4- F8
PVT10395	Lifescience Market	2 ug	EUR 405.00

pENTR223- F8
PVT11401	Lifescience Market	2 ug	EUR 273.00

F8 Conjugated Antibody
C38232	SAB	100ul	EUR 397.00

F8 Polyclonal Antibody
A62534	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

F8 cloning plasmid
CSB-CL007932HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 651 Sequence: atgcggatccaagaccctgggaaggtcttctttggcaatgtggattcatctgggataaaacacaatatttttaaccctccaattattgctcgatacatccgtttgcacccaactcattatagcattcgcagcactcttcgcatggagttgatgggctgtgatttaaatagttgcag Show more
Description: A cloning plasmid for the F8 gene.

F8 Blocking Peptide
33R-3569	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of F8 antibody, catalog no. 70R-9971

anti-F8 (5E9B2)
LF-MA30229	Abfrontier	100 ul	EUR 486.00
Description: Mouse Monoclonal to F8

F8 Antibody, HRP conjugated
1-CSB-PA007932LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

F8 Antibody, FITC conjugated
1-CSB-PA007932LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

F8 Antibody, Biotin conjugated
1-CSB-PA007932LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse F8 shRNA Plasmid
20-abx970267	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Factor VIII (F8) Antibody
20-abx009278	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Factor VIII (F8) Antibody
abx022383-1ml	Abbexa	1 ml	EUR 878.00
Shipped within 5-10 working days.

Factor VIII (F8) Antibody
abx022384-02mg	Abbexa	0.2 mg	EUR 676.00
Shipped within 5-10 working days.

Human F8 shRNA Plasmid
20-abx951499	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

F8 ELISA KIT|Human
EF001353	Lifescience Market	96 Tests	EUR 689.00

Human F8 ELISA Kit
ELA-E0841h	Lifescience Market	96 Tests	EUR 824.00

Canine F8 ELISA KIT
ELI-02861d	Lifescience Market	96 Tests	EUR 928.00

pECMV-3-FLAG-F8
PVT13357	Lifescience Market	2 ug	EUR 599.00

Anti-BMP7 (M1-F8)
YF-MA10098	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to BMP7

Anti-GRLF1 (4D4-F8)
YF-MA13331	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to GRLF1

EasyComp Fluorescent Particles
ECFP-F8	Spherptech	mL	EUR 182.00
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

Monoclonal ACTA1 / ASMA Antibody (clone 5C5.F8.C7), Clone: 5C5.F8.C7
AMM01963G	Leading Biology	0.05mg	EUR 484.00
Description: A Monoclonal antibody against Human ACTA1 / ASMA (clone 5C5.F8.C7). The antibodies are raised in Mouse and are from clone 5C5.F8.C7. This antibody is applicable in IHC-P, IF

F8 Polyclonal Antibody, HRP Conjugated
A62535	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

F8 Polyclonal Antibody, FITC Conjugated
A62536	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

F8 Polyclonal Antibody, Biotin Conjugated
A62537	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Coagulation Factor VIII (F8) Antibody
20-abx001205	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody
20-abx102111	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody
20-abx102112	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody
20-abx102113	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody
20-abx102114	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody
20-abx102115	Abbexa	EUR 467.00 EUR 133.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody
20-abx111706	Abbexa	EUR 996.00 EUR 551.00	150 ul 50 ul
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody
20-abx325763	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody
20-abx301929	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Protein
abx263579-1000IU	Abbexa	1000 IU	EUR 5311.00
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Protein
abx263579-250IU	Abbexa	250 IU	EUR 1790.00
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Protein
abx263579-500IU	Abbexa	500 IU	EUR 3168.00
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody
20-abx175915	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody
20-abx171812	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Coagulation Factor VIII (F8) Antibody
20-abx171813	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Coagulation Factor VIII (F8) Antibody
abx015745-100ul	Abbexa	100 ul	EUR 411.00
Shipped within 5-10 working days.

Anti-Factor VIII/F8 Antibody
PA2061	BosterBio	100ug/vial	EUR 294.00

F8 ORF Vector (Human) (pORF)
ORF003713	ABM	1.0 ug DNA	EUR 95.00

Recombinant Coagulation Factor VIII (F8)
4-RPB878Bo01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: G5E5W1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 39.4kDa Isoelectric Point: 9.9
Description: Recombinant Bovine Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)
4-RPB878Ca01	Cloud-Clone	EUR 528.29 EUR 244.00 EUR 1706.08 EUR 635.36 EUR 1170.72 EUR 416.00 EUR 4115.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O18806 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.2kDa Isoelectric Point: 10.1
Description: Recombinant Dog Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)
4-RPB878Ga01	Cloud-Clone	EUR 386.72 EUR 206.00 EUR 1175.20 EUR 458.40 EUR 816.80 EUR 322.00 EUR 2788.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: F1NPT2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.7kDa Isoelectric Point: 9.6
Description: Recombinant Chicken Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)
4-RPB878Hu01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P00451 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.2kDa Isoelectric Point: 6.8
Description: Recombinant Human Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)
4-RPB878Hu02	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P00451 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.8kDa Isoelectric Point: 6.4
Description: Recombinant Human Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)
4-RPB878Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q06194 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.1kDa Isoelectric Point: 7.9
Description: Recombinant Mouse Coagulation Factor VIII expressed in: Prokaryotic expression

Recombinant Coagulation Factor VIII (F8)
4-RPB878Po01	Cloud-Clone	EUR 537.25 EUR 247.00 EUR 1739.68 EUR 646.56 EUR 1193.12 EUR 422.00 EUR 4199.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12263 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.5kDa Isoelectric Point: 6.4
Description: Recombinant Pig Coagulation Factor VIII expressed in: E.coli

Recombinant Coagulation Factor VIII (F8)
4-RPB878Rb01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: B7NZR5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.7kDa Isoelectric Point: 9.7
Description: Recombinant Rabbit Coagulation Factor VIII expressed in: E.coli

F8 ORF Vector (Mouse) (pORF)
ORF044219	ABM	1.0 ug DNA	EUR 2522.00

F8 ORF Vector (Mouse) (pORF)
ORF044220	ABM	1.0 ug DNA	EUR 2445.00

F8 ORF Vector (Mouse) (pORF)
ORF044221	ABM	1.0 ug DNA	EUR 2447.00

F8 ORF Vector (Rat) (pORF)
ORF066737	ABM	1.0 ug DNA	EUR 2457.00

Monoclonal F8 Antibody, Clone: 5E9B2
AMM04467G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human F8. The antibodies are raised in Mouse and are from clone 5E9B2. This antibody is applicable in WB, E

Anti-RAD9A Antibody (3A3-A7-F8)
A1316-100	Biovision		EUR 338.00

F8 sgRNA CRISPR Lentivector set (Human)
K0707001	ABM	3 x 1.0 ug	EUR 339.00

F8 sgRNA CRISPR Lentivector set (Mouse)
K3845501	ABM	3 x 1.0 ug	EUR 339.00

Coagulation Factor VIII (F8) Antibody (FITC)
20-abx274489	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)
20-abx274552	Abbexa	EUR 439.00 EUR 244.00 EUR 1247.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (FITC)
20-abx271108	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Coagulation Factor VIII (F8) Antibody (FITC)
20-abx271186	Abbexa	EUR 523.00 EUR 258.00 EUR 1581.00 EUR 732.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)
20-abx271374	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)
20-abx271452	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody (HRP)
20-abx303799	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody (FITC)
20-abx303800	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)
20-abx303801	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody (FITC)
20-abx273671	Abbexa	EUR 467.00 EUR 244.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Coagulation Factor VIII (F8) Antibody (Biotin)
20-abx272205	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Coagulation Factor VIII (F8) Protein
20-abx166399	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Coagulation Factor VIII (F8) Protein
20-abx065978	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Coagulation Factor VIII (F8) Protein
20-abx065979	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dog Coagulation Factor VIII (F8) Protein
20-abx065980	Abbexa	EUR 732.00 EUR 286.00 EUR 2291.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Pig Coagulation Factor VIII (F8) Protein
20-abx065981	Abbexa	EUR 746.00 EUR 300.00 EUR 2346.00 EUR 899.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

F8 sgRNA CRISPR Lentivector set (Rat)
K7197701	ABM	3 x 1.0 ug	EUR 339.00

Polyclonal F8 antibody - C-terminal region
APR01421G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human F8 - C-terminal region. This antibody is tested and proven to work in the following applications:

Monoclonal F8 / FVIII / Factor VIII Antibody
AMM01814G	Leading Biology	0.05mg	EUR 484.00
Description: A Monoclonal antibody against Human F8 / FVIII / Factor VIII. The antibodies are raised in Mouse. This antibody is applicable in IHC-P

Polyclonal F8 / FVIII / Factor VIII Antibody
APS00014G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Sheep that recognizes and binds to Human F8 / FVIII / Factor VIII . This antibody is tested and proven to work in the following applications:

Anti-KAP1/TIF1? Antibody (4E1-D12-F8)
A1312-100	Biovision		EUR 338.00

Dog Coagulation Factor VIII (F8) ELISA Kit
20-abx150241	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Coagulation Factor VIII (F8) ELISA Kit
20-abx153975	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Coagulation Factor VIII (F8) ELISA Kit
20-abx151470	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

F8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0707002	ABM	1.0 ug DNA	EUR 154.00

F8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0707003	ABM	1.0 ug DNA	EUR 154.00

F8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0707004	ABM	1.0 ug DNA	EUR 154.00

The consequences for systemic treatment are obvious but it will be most important to collect the clinical data for a better decision process. Last but not least education in dermatology for students will be temporarily not be possible in the classical settings. COVID-19, although not a skin disease by itself has an immense impact on dermatology. This article is protected by copyright. All rights reserved.