Academic performance and use of psychoactive drugs among healthcare students at a university in southern Brazil: cross-sectional study.

People have been using psychoactive substances for a long time. Over the last few years, this practice has spread among university students, who use these substances to improve their academic performance, relieve stress and increase concentration and memory.

To estimate the use of psychoactive drugs among healthcare students at a higher education institution in the city of Passo Fundo (RS), Brazil, and to ascertain the associated demographic and lifestyle factors.Cross-sectional study in a higher education institution.We included 287 undergraduate medicine and dentistry students in this study.

They answered a self-administered questionnaire regarding sociodemographic, lifestyle and health variables. The statistical analysis used univariate and bivariate analyses with Pearson’s chi-square test (P-value < 0.05). -Multivariate analyses were used to estimate odds ratios (OR) and their respective 95% confidence intervals. The SPSS software, version 20.0, was used.The prevalence of use of psychoactive substances among the students was 24.7%.

Among these students, high frequencies of psychoactive drugs had been prescribed by physicians (95.8%) and for the purpose of relaxation or stress relief (73.2%). Women, medicalstudents (compared with dental students) and participants with lower academic performance were more likely to use psychoactive drugs. After the multivariate adjustment, the “course” and “academic performance” remained associated with use of psychoactive drugs.

Canine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-c-96T 96T
EUR 688.00
  • Should the Canine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Von Willebrand Factor (vWF) in samples from plasma.

Human Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Hu-48T 48T
EUR 479.00
  • Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Human Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Hu-96T 96T
EUR 621.00
  • Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Mouse Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Mu-48T 48T
EUR 489.00
  • Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Mouse Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Mu-96T 96T
EUR 635.00
  • Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Porcine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-p-48T 48T
EUR 547.00
  • Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Porcine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-p-96T 96T
EUR 715.00
  • Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Rat Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Ra-48T 48T
EUR 508.00
  • Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Rat Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Ra-96T 96T
EUR 661.00
  • Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Canine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-c-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-c-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-c-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Hu-192 1 kit of 192 tests
EUR 1054.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Hu-48 1 kit of 48 tests
EUR 447.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Hu-96 1 kit of 96 tests
EUR 597.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Mu-192 1 kit of 192 tests
EUR 1079.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Mu-48 1 kit of 48 tests
EUR 456.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Mu-96 1 kit of 96 tests
EUR 609.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-p-192 1 kit of 192 tests
EUR 1231.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-p-48 1 kit of 48 tests
EUR 510.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-p-96 1 kit of 96 tests
EUR 685.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Ra-192 1 kit of 192 tests
EUR 1130.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Ra-48 1 kit of 48 tests
EUR 474.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Ra-96 1 kit of 96 tests
EUR 635.00
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-c-48Tests 48 Tests
EUR 533.00

Canine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-c-96Tests 96 Tests
EUR 740.00

Human Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Hu-48Tests 48 Tests
EUR 478.00

Human Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Hu-96Tests 96 Tests
EUR 662.00

Mouse Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Mu-48Tests 48 Tests
EUR 489.00

Mouse Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Mu-96Tests 96 Tests
EUR 677.00

Porcine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-p-48Tests 48 Tests
EUR 555.00

Porcine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-p-96Tests 96 Tests
EUR 771.00

Rat Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Ra-48Tests 48 Tests
EUR 511.00

Rat Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Ra-96Tests 96 Tests
EUR 709.00

Canine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-c-48Tests 48 Tests
EUR 557.00

Canine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-c-96Tests 96 Tests
EUR 774.00

Human Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Hu-48Tests 48 Tests
EUR 500.00

Human Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Hu-96Tests 96 Tests
EUR 692.00

Mouse Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Mu-48Tests 48 Tests
EUR 511.00

Mouse Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Mu-96Tests 96 Tests
EUR 709.00

Porcine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-p-48Tests 48 Tests
EUR 580.00

Porcine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-p-96Tests 96 Tests
EUR 807.00

Rat Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Ra-48Tests 48 Tests
EUR 534.00

Rat Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Ra-96Tests 96 Tests
EUR 742.00

EIA Diluent

2001-100ml 100 ml
EUR 282.00

EIA Diluent

2001-1L 1 Liter
EUR 1181.00

Cortisol EIA Kit

EK7119 96wells/kit
EUR 478.00

Cortisol EIA Kit

SKT-201-96 1 plate of 96 wells
EUR 329.00
  • Cortisol, C21H30O5, (hydrocortisone, compound F) is the primary glucocorticoid produced and secreted by the adrenal cortex. It is often referred to as the ?stress hormone? as it is involved in the response to stress and it affects blood pressure, blo
  • Show more
Description: Competitive EIA kit used for quantitative measuring cortisol present in Dried Fecal Samples, Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Corticosterone EIA Kit

SKT-205-96 1 plate of 96 wells
EUR 355.00
  • Corticosterone (C21H30O4, Kendall's Compound ?B') is a glucocorticoid secreted by the cortex of the adrenal gland. Corticosterone is produced in response to stimulation of the adrenal cortex by ACTH and is the precursor of aldosterone. Corticosterone
  • Show more
Description: Sandwich EIA kit used to measure the corticosterone present in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media, Dried Fecal Samples samples from all species

Prostaglandin E2 EIA Kit

SKT-207-96 1 plate of 96 wells
EUR 527.00
  • Eicosanoid signal transduction pathways are highly conserved and are involved in a number of physiological processes. Prostaglandins are synthesized from arachidonic acid by cyclooxygenase (COX)-1 or -2, which convert the acid into PGH2. This is furt
  • Show more
Description: Sandwich EIA kit used for quantitative measuring PGE2 present in Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic AMP EIA Kit

SKT-209-96 1 plate of 96 wells
EUR 454.00
  • Adenosine-3',5'-cyclic monophosphate (cyclic AMP) is a second messenger that plays an important role in intracellular regulation. Specifically, it functions as a mediator of activity of several key hormones including epinephrine, glucagon, and ACTH (
  • Show more
Description: Direct EIA kit used for quantitative measuring cAMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic GMP EIA Kit

SKT-211-96 1 plate of 96 wells
EUR 474.00
  • Guanosine 3', 5'-cyclic monophosphate (cyclic GMP
  • cGMP) is a critical and multifunctional second messenger present at levels typically 10-100 fold lower than cAMP in most tissues. Intracellular cGMP is formed by the action of the enzyme guanylate cy
  • Show more
Description: Direct EIA kit used for quantitative measuring cGMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Tissue Culture Media samples from all species

Cystatin C EIA Kit

SKT-219-96 1 plate of 96 wells
EUR 494.00
  • Cystatin C is a non-glycosylated protein of low molecular weight (13kDa) in the cystatin superfamily. Cystatin C is produced at a constant rate in all nucleated cells, secreted from cells and thus found in detectable amounts in most body fluids (1,2)
  • Show more
Description: Sandwich EIA kit used to measure cystatin C levels in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media samples from Human

DM1 ADC EIA Kit

DEIABL311 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-DM1-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of DM1 Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture a

MMAE ADC EIA Kit

DEIABL312 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAE-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAE Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

MMAF ADC EIA Kit

DEIABL313 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAF-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAF Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

vWF Protein

abx069979-100ug 100 ug
EUR 1156.00
  • Shipped within 5-10 working days.

VWF antibody

20R-VG001 2.5 mg
EUR 225.00
Description: Goat polyclonal VWF antibody

VWF antibody

20R-VS001 5 mg
EUR 381.00
Description: Sheep polyclonal VWF antibody

VWF antibody

20R-VS002 5 mg
EUR 303.00
Description: Sheep polyclonal VWF antibody

VWF Antibody

39594-100ul 100ul
EUR 390.00

VWF Antibody

1-CSB-PA292051
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

vWF siRNA

20-abx939623
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

vWF siRNA

20-abx939624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VWF Antibody

BF3001 100 ug
EUR 469.00

VWF protein

30C-CP4002U 100 ug
EUR 705.00
Description: Purified native Human VWF protein

VWF Antibody

35988-100ul 100ul
EUR 252.00

VWF antibody

20C-CR6077SP 1 ml
EUR 241.00
Description: Sheep polyclonal VWF antibody

VWF antibody

20R-1403 5 mg
EUR 303.00
Description: Sheep polyclonal VWF antibody

VWF antibody

70R-10589 500 ug
EUR 512.00
Description: Affinity purified goat polyclonal VWF antibody

VWF antibody

70R-21290 50 ul
EUR 435.00
Description: Rabbit polyclonal VWF antibody

VWF Antibody

1-CSB-PA12779A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VWF Antibody

1-CSB-PA195869
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

VWF Antibody

1-CSB-PA025960GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

VWF Antibody

AF3000 200ul
EUR 376.00
Description: VWF Antibody detects endogenous levels of total VWF.

Androstenedione ELISA Kit (Competitive EIA)

EK7019 96wells/kit, with removable strips.
EUR 688.00

Progesterone EIA kit (One Plate)

K025-H1 1x96 well plate
EUR 305.00

Progesterone EIA kit (Five Plates)

K025-H5 5x96 well plate
EUR 1012.00

Estradiol EIA kit (One Plate)

K030-H1 1x96 well plate
EUR 283.00

Estradiol EIA kit (Five Plates)

K030-H5 5x96 well plate
EUR 985.00

Epiandrosterone EIA Kit (Five Plate)

K063-H5 5x96 well plate
EUR 1545.00

Estriol EIA Kit (One Plate)

K064-H1 1x96 well plate
EUR 327.00

Estriol EIA Kit (Five Plate)

K064-H5 5x96 well plate
EUR 1110.00

Epiandrosterone EIA Kit (One Plate)

K063-H1 1x96 well plate
EUR 436.00

Aldosterone EIA Kit (One Plate)

K052-H1 1x96 well plate
EUR 387.00

Aldosterone EIA Kit (Five Plate)

K052-H5 5x96 well plate
EUR 1355.00

Oxytocin EIA Kit (One Plate)

K048-H1 1x96 well plate
EUR 450.00

Oxytocin EIA Kit (Five Plate)

K048-H5 5x96 well plate
EUR 1597.00

Allopregnanolone EIA Kit (One Plate)

K044-H1 1x96 well plate
EUR 425.00

Allopregnanolone EIA Kit (Five Plate)

K044-H5 5x96 well plate
EUR 1490.00

Testosterone EIA kit (One Plate)

K032-H1 1x96 well plate
EUR 316.00

Testosterone EIA kit (Five Plates)

K032-H5 5x96 well plate
EUR 1045.00

Insulin EIA Kit (One Plate)

K046-H1 1x96 well plate
EUR 501.00

Estrone EIA kit (One Plate)

K031-H1 1x96 well plate
EUR 300.00

Estrone EIA kit (Five Plates)

K031-H5 5x96 well plate
EUR 1001.00

Prolactin EIA kit (One Plate)

K040-H1 1x96 well plate
EUR 471.00

EIA Wash Buffer 10x concentrate

1003-1 1 Liter
EUR 231.00

ImmunoComb Chlamydia Bivalent EIA kit

50416002 1 kit
EUR 370.60
Description: Please check the datasheet of ImmunoComb Chlamydia Bivalent EIA kit before using the test.

VWF, VWFpp Antibody

abx239466-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

VWF: CBA ELISA

55R-1002 96 tests
EUR 909.00
Description: ELISA kit for the detection of von Willebrand Factor

VWF Polyclonal Antibody

A55683 100 µg
EUR 570.55
Description: reagents widely cited

VWF Polyclonal Antibody

ABP60910-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human VWF protein
  • Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF Polyclonal Antibody

ABP60910-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human VWF protein
  • Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF Polyclonal Antibody

ABP60910-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human VWF protein
  • Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF Polyclonal Antibody

E-AB-70006-120uL 120uL
EUR 253.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody

E-AB-70006-200uL 200uL
EUR 400.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody

E-AB-70006-60uL 60uL
EUR 182.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody

E-AB-10679-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v
  • Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Polyclonal Antibody

E-AB-10679-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v
  • Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Polyclonal Antibody

E-AB-10679-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v
  • Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Polyclonal Antibody

ES10984-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC

VWF Polyclonal Antibody

ES10984-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC

VWF cloning plasmid

CSB-CL025960HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgggggcacaggatgaggaggaaggaatccaagacttggatggattattagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagagactgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagagggaccctttg
  • Show more
Description: A cloning plasmid for the VWF gene.

VWF Conjugated Antibody

C35988 100ul
EUR 397.00

VWF antibody (FITC)

60R-1018 100 ug
EUR 358.00
Description: Goat polyclonal VWF antibody (FITC) conjugated

VWF antibody (biotin)

60R-1019 100 ug
EUR 392.00
Description: Goat polyclonal VWF antibody (biotin) conjugated

VWF antibody (HRP)

60R-1021 200 ug
EUR 358.00
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF antibody (HRP)

60R-VG002hrp 150 ug
EUR 358.00
Description: Goat polyclonal VWF antibody (HRP) conjugated

VWF antibody (HRP)

60R-VS001hrp 200 ug
EUR 358.00
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF Blocking Peptide

AF3000-BP 1mg
EUR 195.00

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428.00

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394.00

VWF Rabbit mAb

A13523-100ul 100 ul
EUR 410.00

VWF Rabbit mAb

A13523-200ul 200 ul
EUR 571.00

VWF Rabbit mAb

A13523-20ul 20 ul
EUR 221.00

VWF Rabbit mAb

A13523-50ul 50 ul
EUR 287.00

Human Cotinine ELISA Kit (Competitive EIA)

EK7035 96wells/kit, with removable strips.
EUR 478.00

Human Opiates ELISA Kit (Competitive EIA)

EK7078 96wells/kit, with removable strips.
EUR 478.00

DetectX® Allopregnanolone EIA Antibody, 13ML

C226-13ML 13ML
EUR 1059.00

DetectX® Allopregnanolone EIA Antibody, 3ML

C226-3ML 3ML
EUR 298.00

DetectX® Epiandrosterone EIA Antibody, 13ML

C231-13ML 13ML
EUR 1044.00

DetectX® Epiandrosterone EIA Antibody, 3ML

C231-3ML 3ML
EUR 298.00

Progesterone Metabolites EIA Kit (One Plate)

K068-H1 1x96 well plate
EUR 305.00

Progesterone Metabolites EIA Kit (Five Plate)

K068-H5 5x96 well plate
EUR 1012.00

20-Hydroxyecdysone EIA Kit (One Plate)

K066-H1 1x96 well plate
EUR 511.00

20-Hydroxyecdysone EIA Kit (Five Plate)

K066-H5 5x96 well plate
EUR 1953.00

Retinol Binding Protein Serum EIA Kit

K004-H1 1x96 well plate
EUR 318.00

DNA Damage EIA Kit (One Plate)

K059-H1 1x96 well plate
EUR 552.00

DNA Damage EIA Kit (Five Plate)

K059-H5 5x96 well plate
EUR 2074.00

Myeloperoxidase Human EIA Kit (One Plate)

K060-H1 1x96 well plate
EUR 516.00

DHEA-S EIA Kit (One Plate)

K054-H1 1x96 well plate
EUR 403.00

DHEA-S EIA Kit (Five Plate)

K054-H5 5x96 well plate
EUR 1436.00

ST2 Human EIA Kit, 1 Plate

K055-H1 1x96 well plate
EUR 593.00

Levonorgestrel (LNG) EIA Kit (One Plate)

K058-H1 1x96 well plate
EUR 557.00

Levonorgestrel (LNG) EIA Kit (Five Plate)

K058-H5 5x96 well plate
EUR 2080.00

Thyroxine (T4) EIA kit (One Plate)

K050-H1 1x96 well plate
EUR 400.00

Thyroxine (T4) EIA kit (Five Plates)

K050-H5 5x96 well plate
EUR 1394.00

Triiodothyronine (T3) EIA Kit (One Plate)

K056-H1 1x96 well plate
EUR 400.00

Triiodothyronine (T3) EIA Kit (Five Plate)

K056-H5 5x96 well plate
EUR 1394.00

17-Hydroxyprogesterone EIA kit (One Plate)

K053-H1 1x96 well plate
EUR 566.00

17-Hydroxyprogesterone EIA kit (Five Plate)

K053-H5 5x96 well plate
EUR 1980.00

Estradiol Serum EIA kit (One Plate)

KB30-H1 1x96 well plate
EUR 359.00

Estradiol Serum EIA kit (Five Plates)

KB30-H5 5x96 well plate
EUR 1246.00

Glucagon (human/mouse/rat) EIA Kit

K4756-100
EUR 843.00

Obestatin (human/mouse/rat) EIA Kit

K4759-100 100 assays
EUR 789.00
  • Kit components:
Description: Sensitive, Colorimetric Assay

Resistin (human/mouse/rat) EIA Kit

K4767-100 100 assays
EUR 789.00
  • Kit components:
  • Resistin Microplate (Item A) coated with secondary antibody, 96 wells
  • Wash Buffer Concentrate (20x) (Item B)
  • Standard Resistin Peptide (Item C) (10 μl/vial)
  • Anti-Resistin polyclonal antibody (item N) (5 μl/vial)
  • Assay
  • Show more
Description: Sensitive, Colorimetric Assay

Ghrelin (human, mouse, rat) EIA Kit

K4790-100 100 assays
EUR 789.00
  • Kit components:
  • Ghrelin Microplate (Item A) coated with secondary antibody, 96 wells
  • Wash Buffer Concentrate (20x) (Item B)
  • Lyophilized Standard Ghrelin Peptide (Item C)
  • Lyophilized anti-Ghrelin Polyclonal antibody (Item N)
  • 1 X Assay Dilue
  • Show more
Description: Sensitive, Colorimetric Assay

Retinol Binding Protein Urinary EIA Kit

SKT-218-96 1 plate of 96 wells
EUR 527.00
  • Retinol binding protein (RBP) is from a family of structurally related proteins that bind small hydrophobic molecules such as bile pigments, steroids, odorants, etc (1). RBP is a 21 kDa highly conserved, single-chain glycoprotein, consisting of 182 a
  • Show more
Description: Sandwich EIA kit used to measure RBP levels in urine samples in Urine samples from Human, Rat, Dog, Monkey

Human Chlamydia pneumoniae IgG EIA Kit

DEIA1726 96T
EUR 1177.00
Description: CD's Chlamydia pneumoniae IgG test is developed for the detection of IgG antibodies specific to Chlamydia pneumoniae in human serum or plasma. The kit is semiquantitative allowing comparison of paired samples. The change of antibody level is an aid fo

Human Chlamydia pneumoniae IgM EIA Kit

DEIA1727 96T
EUR 1177.00
Description: Chlamydia pneumoniae IgM test (DEIA1727) is developed for the detection of IgM antibodies specific to Chlamydia pneumoniae in human serum or plasma. The positive result is an aid for the diagnosis of acute Chlamydia pneumonia infection. The test

VWF ELISA KIT|Human

EF001680 96 Tests
EUR 689.00

Human VWF ELISA Kit

ELA-E0833h 96 Tests
EUR 824.00

Mouse VWF shRNA Plasmid

20-abx973382
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VWF shRNA Plasmid

20-abx955097
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VWF Antibody, HRP conjugated

1-CSB-PA12779B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VWF Antibody, FITC conjugated

1-CSB-PA12779C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VWF Antibody, Biotin conjugated

1-CSB-PA12779D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anserini Vwf ELISA Kit

EAV0008 96Tests
EUR 521.00

Anserini VWF ELISA Kit

EAV0053 96Tests
EUR 521.00

Anti-VWF, VWFpp antibody

PAab09466 100 ug
EUR 386.00

Bovine Vwf ELISA Kit

EBV0008 96Tests
EUR 521.00

Bovine VWF ELISA Kit

EBV0053 96Tests
EUR 521.00

Chicken Vwf ELISA Kit

ECKV0008 96Tests
EUR 521.00

Sheep Vwf ELISA Kit

ESV0008 96Tests
EUR 521.00

Rabbit VWF ELISA Kit

ERTV0053 96Tests
EUR 521.00

Rat Vwf ELISA Kit

ERV0008 96Tests
EUR 521.00

Rat VWF ELISA Kit

ERV0053 96Tests
EUR 521.00

Rabbit Vwf ELISA Kit

ERTV0008 96Tests
EUR 521.00

Human Vwf ELISA Kit

EHV0008 96Tests
EUR 521.00

Human VWF ELISA Kit

EHV0053 96Tests
EUR 521.00

Porcine Vwf ELISA Kit

EPV0008 96Tests
EUR 521.00

Porcine VWF ELISA Kit

EPV0053 96Tests
EUR 521.00

Mouse Vwf ELISA Kit

EMV0008 96Tests
EUR 521.00

Mouse VWF ELISA Kit

EMV0053 96Tests
EUR 521.00

Monkey Vwf ELISA Kit

EMKV0008 96Tests
EUR 521.00

Canine Vwf ELISA Kit

ECV0008 96Tests
EUR 521.00

Canine VWF ELISA Kit

ECV0053 96Tests
EUR 521.00

Goat Vwf ELISA Kit

EGTV0008 96Tests
EUR 521.00

There was high prevalence of psychoactive drug use among the students at the higher education institution investigated. Some variables (female sex, medicalstudents and low academic performance) were associated with the outcome.

Scroll to Top