Academic performance and use of psychoactive drugs among healthcare students at a university in southern Brazil: cross-sectional study.

People have been using psychoactive substances for a long time. Over the last few years, this practice has spread among university students, who use these substances to improve their academic performance, relieve stress and increase concentration and memory.

To estimate the use of psychoactive drugs among healthcare students at a higher education institution in the city of Passo Fundo (RS), Brazil, and to ascertain the associated demographic and lifestyle factors.Cross-sectional study in a higher education institution.We included 287 undergraduate medicine and dentistry students in this study.

They answered a self-administered questionnaire regarding sociodemographic, lifestyle and health variables. The statistical analysis used univariate and bivariate analyses with Pearson’s chi-square test (P-value < 0.05). -Multivariate analyses were used to estimate odds ratios (OR) and their respective 95% confidence intervals. The SPSS software, version 20.0, was used.The prevalence of use of psychoactive substances among the students was 24.7%.

Among these students, high frequencies of psychoactive drugs had been prescribed by physicians (95.8%) and for the purpose of relaxation or stress relief (73.2%). Women, medicalstudents (compared with dental students) and participants with lower academic performance were more likely to use psychoactive drugs. After the multivariate adjustment, the “course” and “academic performance” remained associated with use of psychoactive drugs.

Canine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-c-96T 96T
EUR 688
  • Should the Canine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Von Willebrand Factor (vWF) in samples from plasma.

Human Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Hu-48T 48T
EUR 479
  • Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Human Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Hu-96T 96T
EUR 621
  • Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Mouse Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Mu-48T 48T
EUR 489
  • Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Mouse Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Mu-96T 96T
EUR 635
  • Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Porcine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-p-48T 48T
EUR 547
  • Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Porcine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-p-96T 96T
EUR 715
  • Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Rat Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Ra-48T 48T
EUR 508
  • Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Rat Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Ra-96T 96T
EUR 661
  • Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Canine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-c-48Tests 48 Tests
EUR 557

Canine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-c-96Tests 96 Tests
EUR 774

Human Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Hu-48Tests 48 Tests
EUR 500

Human Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Hu-96Tests 96 Tests
EUR 692

Mouse Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Mu-48Tests 48 Tests
EUR 511

Mouse Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Mu-96Tests 96 Tests
EUR 709

Porcine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-p-48Tests 48 Tests
EUR 580

Porcine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-p-96Tests 96 Tests
EUR 807

Rat Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Ra-48Tests 48 Tests
EUR 534

Rat Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Ra-96Tests 96 Tests
EUR 742

Canine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-c-48Tests 48 Tests
EUR 533

Canine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-c-96Tests 96 Tests
EUR 740

Human Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Hu-48Tests 48 Tests
EUR 478

Human Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Hu-96Tests 96 Tests
EUR 662

Mouse Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Mu-48Tests 48 Tests
EUR 489

Mouse Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Mu-96Tests 96 Tests
EUR 677

Porcine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-p-48Tests 48 Tests
EUR 555

Porcine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-p-96Tests 96 Tests
EUR 771

Rat Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Ra-48Tests 48 Tests
EUR 511

Rat Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Ra-96Tests 96 Tests
EUR 709

EIA Diluent

2001-100ml 100 ml
EUR 282

EIA Diluent

2001-1L 1 Liter
EUR 1181

Cortisol EIA Kit

EK7119 96wells/kit
EUR 478

Cortisol EIA Kit

SKT-201-96 1 plate of 96 wells
EUR 329
  • Cortisol, C21H30O5, (hydrocortisone, compound F) is the primary glucocorticoid produced and secreted by the adrenal cortex. It is often referred to as the ?stress hormone? as it is involved in the response to stress and it affects blood pressure, blo
  • Show more
Description: Competitive EIA kit used for quantitative measuring cortisol present in Dried Fecal Samples, Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Corticosterone EIA Kit

SKT-205-96 1 plate of 96 wells
EUR 355
  • Corticosterone (C21H30O4, Kendall's Compound ?B') is a glucocorticoid secreted by the cortex of the adrenal gland. Corticosterone is produced in response to stimulation of the adrenal cortex by ACTH and is the precursor of aldosterone. Corticosterone
  • Show more
Description: Sandwich EIA kit used to measure the corticosterone present in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media, Dried Fecal Samples samples from all species

VWF protein

30C-CP4002U 100 ug
EUR 705
Description: Purified native Human VWF protein

VWF antibody

20C-CR6077SP 1 ml
EUR 241
Description: Sheep polyclonal VWF antibody

VWF antibody

20R-1403 5 mg
EUR 303
Description: Sheep polyclonal VWF antibody

VWF antibody

20R-VG001 2.5 mg
EUR 225
Description: Goat polyclonal VWF antibody

VWF antibody

20R-VS001 5 mg
EUR 381
Description: Sheep polyclonal VWF antibody

VWF antibody

20R-VS002 5 mg
EUR 303
Description: Sheep polyclonal VWF antibody

VWF antibody

70R-10589 500 ug
EUR 512
Description: Affinity purified goat polyclonal VWF antibody

VWF antibody

70R-21290 50 ul
EUR 435
Description: Rabbit polyclonal VWF antibody

VWF Antibody

35988-100ul 100ul
EUR 252

VWF Antibody

39594-100ul 100ul
EUR 390

VWF Antibody

1-CSB-PA12779A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VWF Antibody

1-CSB-PA292051
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

VWF Antibody

1-CSB-PA195869
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

VWF Antibody

1-CSB-PA025960GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

vWF Protein

abx069979-100ug 100 ug
EUR 1156
  • Shipped within 5-10 working days.

VWF Antibody

AF3000 200ul
EUR 376
Description: VWF Antibody detects endogenous levels of total VWF.

VWF Antibody

BF3001 100 ug
EUR 469

vWF siRNA

20-abx939623
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

vWF siRNA

20-abx939624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DM1 ADC EIA Kit

DEIABL311 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-DM1-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of DM1 Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture a

MMAE ADC EIA Kit

DEIABL312 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAE-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAE Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

MMAF ADC EIA Kit

DEIABL313 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAF-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAF Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

Prostaglandin E2 EIA Kit

SKT-207-96 1 plate of 96 wells
EUR 527
  • Eicosanoid signal transduction pathways are highly conserved and are involved in a number of physiological processes. Prostaglandins are synthesized from arachidonic acid by cyclooxygenase (COX)-1 or -2, which convert the acid into PGH2. This is furt
  • Show more
Description: Sandwich EIA kit used for quantitative measuring PGE2 present in Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic AMP EIA Kit

SKT-209-96 1 plate of 96 wells
EUR 454
  • Adenosine-3',5'-cyclic monophosphate (cyclic AMP) is a second messenger that plays an important role in intracellular regulation. Specifically, it functions as a mediator of activity of several key hormones including epinephrine, glucagon, and ACTH (
  • Show more
Description: Direct EIA kit used for quantitative measuring cAMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic GMP EIA Kit

SKT-211-96 1 plate of 96 wells
EUR 474
  • Guanosine 3', 5'-cyclic monophosphate (cyclic GMP
  • cGMP) is a critical and multifunctional second messenger present at levels typically 10-100 fold lower than cAMP in most tissues. Intracellular cGMP is formed by the action of the enzyme guanylate cy
  • Show more
Description: Direct EIA kit used for quantitative measuring cGMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Tissue Culture Media samples from all species

Cystatin C EIA Kit

SKT-219-96 1 plate of 96 wells
EUR 494
  • Cystatin C is a non-glycosylated protein of low molecular weight (13kDa) in the cystatin superfamily. Cystatin C is produced at a constant rate in all nucleated cells, secreted from cells and thus found in detectable amounts in most body fluids (1,2)
  • Show more
Description: Sandwich EIA kit used to measure cystatin C levels in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media samples from Human

EIA Wash Buffer 10x concentrate

1003-1 1 Liter
EUR 231

ImmunoComb Chlamydia Bivalent EIA kit

50416002 1 kit
EUR 370.6
Description: Please check the datasheet of ImmunoComb Chlamydia Bivalent EIA kit before using the test.

Androstenedione ELISA Kit (Competitive EIA)

EK7019 96wells/kit, with removable strips.
EUR 688

Aldosterone EIA Kit (One Plate)

K052-H1 1x96 well plate
EUR 387

Aldosterone EIA Kit (Five Plate)

K052-H5 5x96 well plate
EUR 1355

Estriol EIA Kit (One Plate)

K064-H1 1x96 well plate
EUR 327

Estriol EIA Kit (Five Plate)

K064-H5 5x96 well plate
EUR 1110

Allopregnanolone EIA Kit (One Plate)

K044-H1 1x96 well plate
EUR 425

Allopregnanolone EIA Kit (Five Plate)

K044-H5 5x96 well plate
EUR 1490

Insulin EIA Kit (One Plate)

K046-H1 1x96 well plate
EUR 501

Prolactin EIA kit (One Plate)

K040-H1 1x96 well plate
EUR 471

Oxytocin EIA Kit (One Plate)

K048-H1 1x96 well plate
EUR 450

Oxytocin EIA Kit (Five Plate)

K048-H5 5x96 well plate
EUR 1597

Epiandrosterone EIA Kit (One Plate)

K063-H1 1x96 well plate
EUR 436

Epiandrosterone EIA Kit (Five Plate)

K063-H5 5x96 well plate
EUR 1545

Estradiol EIA kit (One Plate)

K030-H1 1x96 well plate
EUR 283

Estradiol EIA kit (Five Plates)

K030-H5 5x96 well plate
EUR 985

Estrone EIA kit (One Plate)

K031-H1 1x96 well plate
EUR 300

Estrone EIA kit (Five Plates)

K031-H5 5x96 well plate
EUR 1001

Testosterone EIA kit (One Plate)

K032-H1 1x96 well plate
EUR 316

Testosterone EIA kit (Five Plates)

K032-H5 5x96 well plate
EUR 1045

Progesterone EIA kit (One Plate)

K025-H1 1x96 well plate
EUR 305

Progesterone EIA kit (Five Plates)

K025-H5 5x96 well plate
EUR 1012

VWF Rabbit mAb

A13523-100ul 100 ul
EUR 410

VWF Rabbit mAb

A13523-200ul 200 ul
EUR 571

VWF Rabbit mAb

A13523-20ul 20 ul
EUR 221

VWF Rabbit mAb

A13523-50ul 50 ul
EUR 287

VWF antibody (FITC)

60R-1018 100 ug
EUR 358
Description: Goat polyclonal VWF antibody (FITC) conjugated

VWF antibody (biotin)

60R-1019 100 ug
EUR 392
Description: Goat polyclonal VWF antibody (biotin) conjugated

VWF antibody (HRP)

60R-1021 200 ug
EUR 358
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF antibody (HRP)

60R-VG002hrp 150 ug
EUR 358
Description: Goat polyclonal VWF antibody (HRP) conjugated

VWF antibody (HRP)

60R-VS001hrp 200 ug
EUR 358
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF: CBA ELISA

55R-1002 96 tests
EUR 909
Description: ELISA kit for the detection of von Willebrand Factor

VWF, VWFpp Antibody

abx239466-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

VWF Blocking Peptide

AF3000-BP 1mg
EUR 195

VWF Conjugated Antibody

C35988 100ul
EUR 397

VWF cloning plasmid

CSB-CL025960HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgggggcacaggatgaggaggaaggaatccaagacttggatggattattagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagagactgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagagggaccctttg
  • Show more
Description: A cloning plasmid for the VWF gene.

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

There was high prevalence of psychoactive drug use among the students at the higher education institution investigated. Some variables (female sex, medicalstudents and low academic performance) were associated with the outcome.