People have been using psychoactive substances for a long time. Over the last few years, this practice has spread among university students, who use these substances to improve their academic performance, relieve stress and increase concentration and memory.
To estimate the use of psychoactive drugs among healthcare students at a higher education institution in the city of Passo Fundo (RS), Brazil, and to ascertain the associated demographic and lifestyle factors.Cross-sectional study in a higher education institution.We included 287 undergraduate medicine and dentistry students in this study.
They answered a self-administered questionnaire regarding sociodemographic, lifestyle and health variables. The statistical analysis used univariate and bivariate analyses with Pearson’s chi-square test (P-value < 0.05). -Multivariate analyses were used to estimate odds ratios (OR) and their respective 95% confidence intervals. The SPSS software, version 20.0, was used.The prevalence of use of psychoactive substances among the students was 24.7%.
Among these students, high frequencies of psychoactive drugs had been prescribed by physicians (95.8%) and for the purpose of relaxation or stress relief (73.2%). Women, medicalstudents (compared with dental students) and participants with lower academic performance were more likely to use psychoactive drugs. After the multivariate adjustment, the “course” and “academic performance” remained associated with use of psychoactive drugs.
Canine Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-c-96T |
DL Develop |
96T |
EUR 688 |
- Should the Canine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Canine Von Willebrand Factor (vWF) in samples from plasma. |
Human Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids. |
Human Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids. |
Mouse Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma. |
Mouse Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma. |
Porcine Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-p-48T |
DL Develop |
48T |
EUR 547 |
- Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids. |
Porcine Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-p-96T |
DL Develop |
96T |
EUR 715 |
- Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids. |
Rat Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma. |
Rat Von Willebrand Factor (vWF) ELISA Kit |
DLR-vWF-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma. |
Canine Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Canine Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Porcine Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Porcine Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Rat Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Von Willebrand Factor (vWF) ELISA Kit |
RDR-vWF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Canine Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Canine Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Porcine Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Porcine Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Rat Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Von Willebrand Factor (vWF) ELISA Kit |
RD-vWF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Cortisol EIA Kit |
EK7119 |
BosterBio |
96wells/kit |
EUR 478 |
Cortisol EIA Kit |
SKT-201-96 |
Stressmarq |
1 plate of 96 wells |
EUR 329 |
- Cortisol, C21H30O5, (hydrocortisone, compound F) is the primary glucocorticoid produced and secreted by the adrenal cortex. It is often referred to as the ?stress hormone? as it is involved in the response to stress and it affects blood pressure, blo
- Show more
|
Description: Competitive EIA kit used for quantitative measuring cortisol present in Dried Fecal Samples, Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species |
Corticosterone EIA Kit |
SKT-205-96 |
Stressmarq |
1 plate of 96 wells |
EUR 355 |
- Corticosterone (C21H30O4, Kendall's Compound ?B') is a glucocorticoid secreted by the cortex of the adrenal gland. Corticosterone is produced in response to stimulation of the adrenal cortex by ACTH and is the precursor of aldosterone. Corticosterone
- Show more
|
Description: Sandwich EIA kit used to measure the corticosterone present in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media, Dried Fecal Samples samples from all species |
VWF protein |
30C-CP4002U |
Fitzgerald |
100 ug |
EUR 705 |
Description: Purified native Human VWF protein |
VWF antibody |
20C-CR6077SP |
Fitzgerald |
1 ml |
EUR 241 |
Description: Sheep polyclonal VWF antibody |
VWF antibody |
20R-1403 |
Fitzgerald |
5 mg |
EUR 303 |
Description: Sheep polyclonal VWF antibody |
VWF antibody |
20R-VG001 |
Fitzgerald |
2.5 mg |
EUR 225 |
Description: Goat polyclonal VWF antibody |
VWF antibody |
20R-VS001 |
Fitzgerald |
5 mg |
EUR 381 |
Description: Sheep polyclonal VWF antibody |
VWF antibody |
20R-VS002 |
Fitzgerald |
5 mg |
EUR 303 |
Description: Sheep polyclonal VWF antibody |
VWF antibody |
70R-10589 |
Fitzgerald |
500 ug |
EUR 512 |
Description: Affinity purified goat polyclonal VWF antibody |
VWF antibody |
70R-21290 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal VWF antibody |
VWF Antibody |
35988-100ul |
SAB |
100ul |
EUR 252 |
VWF Antibody |
39594-100ul |
SAB |
100ul |
EUR 390 |
VWF Antibody |
1-CSB-PA12779A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
VWF Antibody |
1-CSB-PA292051 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
VWF Antibody |
1-CSB-PA195869 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
VWF Antibody |
1-CSB-PA025960GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against VWF. Recognizes VWF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
vWF Protein |
abx069979-100ug |
Abbexa |
100 ug |
EUR 1156 |
- Shipped within 5-10 working days.
|
VWF Antibody |
AF3000 |
Affbiotech |
200ul |
EUR 376 |
Description: VWF Antibody detects endogenous levels of total VWF. |
vWF siRNA |
20-abx939623 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
vWF siRNA |
20-abx939624 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DM1 ADC EIA Kit |
DEIABL311 |
Creative Diagnostics |
96T |
Ask for price |
Description: This test kit is intended for use in the quantitative determination of antibody-DM1-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of DM1 Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture a |
MMAE ADC EIA Kit |
DEIABL312 |
Creative Diagnostics |
96T |
Ask for price |
Description: This test kit is intended for use in the quantitative determination of antibody-MMAE-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAE Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture |
MMAF ADC EIA Kit |
DEIABL313 |
Creative Diagnostics |
96T |
Ask for price |
Description: This test kit is intended for use in the quantitative determination of antibody-MMAF-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAF Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture |
Prostaglandin E2 EIA Kit |
SKT-207-96 |
Stressmarq |
1 plate of 96 wells |
EUR 527 |
- Eicosanoid signal transduction pathways are highly conserved and are involved in a number of physiological processes. Prostaglandins are synthesized from arachidonic acid by cyclooxygenase (COX)-1 or -2, which convert the acid into PGH2. This is furt
- Show more
|
Description: Sandwich EIA kit used for quantitative measuring PGE2 present in Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species |
Cyclic AMP EIA Kit |
SKT-209-96 |
Stressmarq |
1 plate of 96 wells |
EUR 454 |
- Adenosine-3',5'-cyclic monophosphate (cyclic AMP) is a second messenger that plays an important role in intracellular regulation. Specifically, it functions as a mediator of activity of several key hormones including epinephrine, glucagon, and ACTH (
- Show more
|
Description: Direct EIA kit used for quantitative measuring cAMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species |
Cyclic GMP EIA Kit |
SKT-211-96 |
Stressmarq |
1 plate of 96 wells |
EUR 474 |
- Guanosine 3', 5'-cyclic monophosphate (cyclic GMP
- cGMP) is a critical and multifunctional second messenger present at levels typically 10-100 fold lower than cAMP in most tissues. Intracellular cGMP is formed by the action of the enzyme guanylate cy
- Show more
|
Description: Direct EIA kit used for quantitative measuring cGMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Tissue Culture Media samples from all species |
Cystatin C EIA Kit |
SKT-219-96 |
Stressmarq |
1 plate of 96 wells |
EUR 494 |
- Cystatin C is a non-glycosylated protein of low molecular weight (13kDa) in the cystatin superfamily. Cystatin C is produced at a constant rate in all nucleated cells, secreted from cells and thus found in detectable amounts in most body fluids (1,2)
- Show more
|
Description: Sandwich EIA kit used to measure cystatin C levels in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media samples from Human |
ImmunoComb Chlamydia Bivalent EIA kit |
50416002 |
Bionote |
1 kit |
EUR 370.6 |
Description: Please check the datasheet of ImmunoComb Chlamydia Bivalent EIA kit before using the test. |
Androstenedione ELISA Kit (Competitive EIA) |
EK7019 |
BosterBio |
96wells/kit, with removable strips. |
EUR 688 |
Aldosterone EIA Kit (One Plate) |
K052-H1 |
Arbor Assays |
1x96 well plate |
EUR 387 |
Aldosterone EIA Kit (Five Plate) |
K052-H5 |
Arbor Assays |
5x96 well plate |
EUR 1355 |
Estriol EIA Kit (One Plate) |
K064-H1 |
Arbor Assays |
1x96 well plate |
EUR 327 |
Estriol EIA Kit (Five Plate) |
K064-H5 |
Arbor Assays |
5x96 well plate |
EUR 1110 |
Allopregnanolone EIA Kit (One Plate) |
K044-H1 |
Arbor Assays |
1x96 well plate |
EUR 425 |
Allopregnanolone EIA Kit (Five Plate) |
K044-H5 |
Arbor Assays |
5x96 well plate |
EUR 1490 |
Insulin EIA Kit (One Plate) |
K046-H1 |
Arbor Assays |
1x96 well plate |
EUR 501 |
Prolactin EIA kit (One Plate) |
K040-H1 |
Arbor Assays |
1x96 well plate |
EUR 471 |
Oxytocin EIA Kit (One Plate) |
K048-H1 |
Arbor Assays |
1x96 well plate |
EUR 450 |
Oxytocin EIA Kit (Five Plate) |
K048-H5 |
Arbor Assays |
5x96 well plate |
EUR 1597 |
Epiandrosterone EIA Kit (One Plate) |
K063-H1 |
Arbor Assays |
1x96 well plate |
EUR 436 |
Epiandrosterone EIA Kit (Five Plate) |
K063-H5 |
Arbor Assays |
5x96 well plate |
EUR 1545 |
Estradiol EIA kit (One Plate) |
K030-H1 |
Arbor Assays |
1x96 well plate |
EUR 283 |
Estradiol EIA kit (Five Plates) |
K030-H5 |
Arbor Assays |
5x96 well plate |
EUR 985 |
Estrone EIA kit (One Plate) |
K031-H1 |
Arbor Assays |
1x96 well plate |
EUR 300 |
Estrone EIA kit (Five Plates) |
K031-H5 |
Arbor Assays |
5x96 well plate |
EUR 1001 |
Testosterone EIA kit (One Plate) |
K032-H1 |
Arbor Assays |
1x96 well plate |
EUR 316 |
Testosterone EIA kit (Five Plates) |
K032-H5 |
Arbor Assays |
5x96 well plate |
EUR 1045 |
Progesterone EIA kit (One Plate) |
K025-H1 |
Arbor Assays |
1x96 well plate |
EUR 305 |
Progesterone EIA kit (Five Plates) |
K025-H5 |
Arbor Assays |
5x96 well plate |
EUR 1012 |
VWF Rabbit mAb |
A13523-100ul |
Abclonal |
100 ul |
EUR 410 |
VWF Rabbit mAb |
A13523-200ul |
Abclonal |
200 ul |
EUR 571 |
VWF Rabbit mAb |
A13523-20ul |
Abclonal |
20 ul |
EUR 221 |
VWF Rabbit mAb |
A13523-50ul |
Abclonal |
50 ul |
EUR 287 |
VWF antibody (FITC) |
60R-1018 |
Fitzgerald |
100 ug |
EUR 358 |
Description: Goat polyclonal VWF antibody (FITC) conjugated |
VWF antibody (biotin) |
60R-1019 |
Fitzgerald |
100 ug |
EUR 392 |
Description: Goat polyclonal VWF antibody (biotin) conjugated |
VWF antibody (HRP) |
60R-1021 |
Fitzgerald |
200 ug |
EUR 358 |
Description: Sheep polyclonal VWF antibody (HRP) conjugated |
VWF antibody (HRP) |
60R-VG002hrp |
Fitzgerald |
150 ug |
EUR 358 |
Description: Goat polyclonal VWF antibody (HRP) conjugated |
VWF antibody (HRP) |
60R-VS001hrp |
Fitzgerald |
200 ug |
EUR 358 |
Description: Sheep polyclonal VWF antibody (HRP) conjugated |
VWF: CBA ELISA |
55R-1002 |
Fitzgerald |
96 tests |
EUR 909 |
Description: ELISA kit for the detection of von Willebrand Factor |
VWF, VWFpp Antibody |
abx239466-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
VWF Blocking Peptide |
AF3000-BP |
Affbiotech |
1mg |
EUR 195 |
VWF Conjugated Antibody |
C35988 |
SAB |
100ul |
EUR 397 |
VWF cloning plasmid |
CSB-CL025960HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 822
- Sequence: atgggggcacaggatgaggaggaaggaatccaagacttggatggattattagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagagactgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagagggaccctttg
- Show more
|
Description: A cloning plasmid for the VWF gene. |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
VWF Polyclonal Antibody |
A55683 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
VWF Polyclonal Antibody |
ABP60910-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VWF protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein |
VWF Polyclonal Antibody |
ABP60910-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VWF protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein |
VWF Polyclonal Antibody |
ABP60910-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VWF protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein |
VWF Polyclonal Antibody |
ES10984-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VWF Polyclonal Antibody |
ES10984-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Anti-VWF antibody |
STJ192142 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VWF |
Human Chlamydia pneumoniae IgG EIA Kit |
DEIA1726 |
Creative Diagnostics |
96T |
EUR 1177 |
Description: CD's Chlamydia pneumoniae IgG test is developed for the detection of IgG antibodies specific to Chlamydia pneumoniae in human serum or plasma. The kit is semiquantitative allowing comparison of paired samples. The change of antibody level is an aid fo |
Human Chlamydia pneumoniae IgM EIA Kit |
DEIA1727 |
Creative Diagnostics |
96T |
EUR 1177 |
Description: Chlamydia pneumoniae IgM test (DEIA1727) is developed for the detection of IgM antibodies specific to Chlamydia pneumoniae in human serum or plasma. The positive result is an aid for the diagnosis of acute Chlamydia pneumonia infection. The test |
Human Cotinine ELISA Kit (Competitive EIA) |
EK7035 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Opiates ELISA Kit (Competitive EIA) |
EK7078 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
DetectX® Allopregnanolone EIA Antibody, 13ML |
C226-13ML |
Arbor Assays |
13ML |
EUR 1059 |
DetectX® Allopregnanolone EIA Antibody, 3ML |
C226-3ML |
Arbor Assays |
3ML |
EUR 298 |
DetectX® Epiandrosterone EIA Antibody, 13ML |
C231-13ML |
Arbor Assays |
13ML |
EUR 1044 |
DetectX® Epiandrosterone EIA Antibody, 3ML |
C231-3ML |
Arbor Assays |
3ML |
EUR 298 |
Resistin (human/mouse/rat) EIA Kit |
K4767-100 |
Biovision |
100 assays |
EUR 789 |
- Kit components:
- Resistin Microplate (Item A) coated with secondary antibody, 96 wells
- Wash Buffer Concentrate (20x) (Item B)
- Standard Resistin Peptide (Item C) (10 μl/vial)
- Anti-Resistin polyclonal antibody (item N) (5 μl/vial)
- Assay
- Show more
|
Description: Sensitive, Colorimetric Assay |
Ghrelin (human, mouse, rat) EIA Kit |
K4790-100 |
Biovision |
100 assays |
EUR 789 |
- Kit components:
- Ghrelin Microplate (Item A) coated with secondary antibody, 96 wells
- Wash Buffer Concentrate (20x) (Item B)
- Lyophilized Standard Ghrelin Peptide (Item C)
- Lyophilized anti-Ghrelin Polyclonal antibody (Item N)
- 1 X Assay Dilue
- Show more
|
Description: Sensitive, Colorimetric Assay |
Glucagon (human/mouse/rat) EIA Kit |
K4756-100 |
Biovision |
|
EUR 843 |
Obestatin (human/mouse/rat) EIA Kit |
K4759-100 |
Biovision |
100 assays |
EUR 789 |
|
Description: Sensitive, Colorimetric Assay |
17-Hydroxyprogesterone EIA kit (One Plate) |
K053-H1 |
Arbor Assays |
1x96 well plate |
EUR 566 |
17-Hydroxyprogesterone EIA kit (Five Plate) |
K053-H5 |
Arbor Assays |
5x96 well plate |
EUR 1980 |
DHEA-S EIA Kit (One Plate) |
K054-H1 |
Arbor Assays |
1x96 well plate |
EUR 403 |
DHEA-S EIA Kit (Five Plate) |
K054-H5 |
Arbor Assays |
5x96 well plate |
EUR 1436 |
ST2 Human EIA Kit, 1 Plate |
K055-H1 |
Arbor Assays |
1x96 well plate |
EUR 593 |
Triiodothyronine (T3) EIA Kit (One Plate) |
K056-H1 |
Arbor Assays |
1x96 well plate |
EUR 400 |
Triiodothyronine (T3) EIA Kit (Five Plate) |
K056-H5 |
Arbor Assays |
5x96 well plate |
EUR 1394 |
Levonorgestrel (LNG) EIA Kit (One Plate) |
K058-H1 |
Arbor Assays |
1x96 well plate |
EUR 557 |
Levonorgestrel (LNG) EIA Kit (Five Plate) |
K058-H5 |
Arbor Assays |
5x96 well plate |
EUR 2080 |
20-Hydroxyecdysone EIA Kit (One Plate) |
K066-H1 |
Arbor Assays |
1x96 well plate |
EUR 511 |
20-Hydroxyecdysone EIA Kit (Five Plate) |
K066-H5 |
Arbor Assays |
5x96 well plate |
EUR 1953 |
Progesterone Metabolites EIA Kit (One Plate) |
K068-H1 |
Arbor Assays |
1x96 well plate |
EUR 305 |
Progesterone Metabolites EIA Kit (Five Plate) |
K068-H5 |
Arbor Assays |
5x96 well plate |
EUR 1012 |
Thyroxine (T4) EIA kit (One Plate) |
K050-H1 |
Arbor Assays |
1x96 well plate |
EUR 400 |
Thyroxine (T4) EIA kit (Five Plates) |
K050-H5 |
Arbor Assays |
5x96 well plate |
EUR 1394 |
Myeloperoxidase Human EIA Kit (One Plate) |
K060-H1 |
Arbor Assays |
1x96 well plate |
EUR 516 |
DNA Damage EIA Kit (One Plate) |
K059-H1 |
Arbor Assays |
1x96 well plate |
EUR 552 |
DNA Damage EIA Kit (Five Plate) |
K059-H5 |
Arbor Assays |
5x96 well plate |
EUR 2074 |
Estradiol Serum EIA kit (One Plate) |
KB30-H1 |
Arbor Assays |
1x96 well plate |
EUR 359 |
Estradiol Serum EIA kit (Five Plates) |
KB30-H5 |
Arbor Assays |
5x96 well plate |
EUR 1246 |
Retinol Binding Protein Serum EIA Kit |
K004-H1 |
Arbor Assays |
1x96 well plate |
EUR 318 |
Retinol Binding Protein Urinary EIA Kit |
SKT-218-96 |
Stressmarq |
1 plate of 96 wells |
EUR 527 |
- Retinol binding protein (RBP) is from a family of structurally related proteins that bind small hydrophobic molecules such as bile pigments, steroids, odorants, etc (1). RBP is a 21 kDa highly conserved, single-chain glycoprotein, consisting of 182 a
- Show more
|
Description: Sandwich EIA kit used to measure RBP levels in urine samples in Urine samples from Human, Rat, Dog, Monkey |
VWF Antibody, HRP conjugated |
1-CSB-PA12779B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VWF Antibody, FITC conjugated |
1-CSB-PA12779C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VWF Antibody, Biotin conjugated |
1-CSB-PA12779D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human Vwf ELISA Kit |
EHV0008 |
Abclonal |
96Tests |
EUR 521 |
Human VWF ELISA Kit |
EHV0053 |
Abclonal |
96Tests |
EUR 521 |
Bovine Vwf ELISA Kit |
EBV0008 |
Abclonal |
96Tests |
EUR 521 |
Bovine VWF ELISA Kit |
EBV0053 |
Abclonal |
96Tests |
EUR 521 |
Anserini Vwf ELISA Kit |
EAV0008 |
Abclonal |
96Tests |
EUR 521 |
Anserini VWF ELISA Kit |
EAV0053 |
Abclonal |
96Tests |
EUR 521 |
Chicken Vwf ELISA Kit |
ECKV0008 |
Abclonal |
96Tests |
EUR 521 |
Canine Vwf ELISA Kit |
ECV0008 |
Abclonal |
96Tests |
EUR 521 |
Canine VWF ELISA Kit |
ECV0053 |
Abclonal |
96Tests |
EUR 521 |
Goat Vwf ELISA Kit |
EGTV0008 |
Abclonal |
96Tests |
EUR 521 |
Goat VWF ELISA Kit |
EGTV0053 |
Abclonal |
96Tests |
EUR 521 |
Mouse VWF shRNA Plasmid |
20-abx973382 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human VWF shRNA Plasmid |
20-abx955097 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Sheep Vwf ELISA Kit |
ESV0008 |
Abclonal |
96Tests |
EUR 521 |
Porcine Vwf ELISA Kit |
EPV0008 |
Abclonal |
96Tests |
EUR 521 |
Porcine VWF ELISA Kit |
EPV0053 |
Abclonal |
96Tests |
EUR 521 |
anti- VWF, VWFpp antibody |
FNab09466 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:100-1:400
- Immunogen: von Willebrand factor
- Uniprot ID: P04275
- Research Area: Immunology, Cardiovascular
|
Description: Antibody raised against VWF, VWFpp |
Rabbit Vwf ELISA Kit |
ERTV0008 |
Abclonal |
96Tests |
EUR 521 |
Rabbit VWF ELISA Kit |
ERTV0053 |
Abclonal |
96Tests |
EUR 521 |
Rat Vwf ELISA Kit |
ERV0008 |
Abclonal |
96Tests |
EUR 521 |
Rat VWF ELISA Kit |
ERV0053 |
Abclonal |
96Tests |
EUR 521 |
Monkey Vwf ELISA Kit |
EMKV0008 |
Abclonal |
96Tests |
EUR 521 |
Mouse Vwf ELISA Kit |
EMV0008 |
Abclonal |
96Tests |
EUR 521 |
Mouse VWF ELISA Kit |
EMV0053 |
Abclonal |
96Tests |
EUR 521 |
Von Willebrand Factor (VWF) |
RA25102 |
Neuromics |
0.1 ml |
EUR 631 |
Rat VWF ELISA Kit |
STJ150412 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of VWF in Rat serum, plasma and other biological fluids |
Mouse VWF ELISA Kit |
STJ150490 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of vWF in Mouse serum, plasma and other biological fluids |
ANA IgG Screening ELISA Kit (Direct EIA) |
EK7016 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Brucella IgG ELISA Kit (Direct EIA) |
EK7021 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Brucella IgM ELISA Kit (Direct EIA) |
EK7022 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Cardiolipin IgG ELISA Kit (Direct EIA) |
EK7024 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Cardiolipin IgA ELISA Kit (Direct EIA) |
EK7025 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Cardiolipin IgM ELISA Kit (Direct EIA) |
EK7026 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human DHEA-S ELISA Kit (Competitive EIA) |
EK7047 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Free Testosterone ELISA Kit (Competitive EIA) |
EK7057 |
BosterBio |
96wells/kit, with removable strips. |
EUR 572 |
Human Morphine Specific ELISA Kit (Competitive EIA) |
EK7070 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Mumps IgG ELISA Kit (Direct EIA) |
EK7073 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Mumps IgM ELISA Kit (Direct EIA) |
EK7074 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Rubella IgG ELISA Kit (Direct EIA) |
EK7082 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Rubella IgM ELISA Kit (Direct EIA) |
EK7083 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Toxoplasma IgG ELISA Kit (Direct EIA) |
EK7099 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
Human Toxoplasma IgA ELISA Kit (Direct EIA) |
EK7100 |
BosterBio |
96wells/kit, with removable strips. |
EUR 478 |
There was high prevalence of psychoactive drug use among the students at the higher education institution investigated. Some variables (female sex, medicalstudents and low academic performance) were associated with the outcome.