Academic performance and use of psychoactive drugs among healthcare students at a university in southern Brazil: cross-sectional study.

People have been using psychoactive substances for a long time. Over the last few years, this practice has spread among university students, who use these substances to improve their academic performance, relieve stress and increase concentration and memory.

To estimate the use of psychoactive drugs among healthcare students at a higher education institution in the city of Passo Fundo (RS), Brazil, and to ascertain the associated demographic and lifestyle factors.Cross-sectional study in a higher education institution.We included 287 undergraduate medicine and dentistry students in this study.

They answered a self-administered questionnaire regarding sociodemographic, lifestyle and health variables. The statistical analysis used univariate and bivariate analyses with Pearson’s chi-square test (P-value < 0.05). -Multivariate analyses were used to estimate odds ratios (OR) and their respective 95% confidence intervals. The SPSS software, version 20.0, was used.The prevalence of use of psychoactive substances among the students was 24.7%.

Among these students, high frequencies of psychoactive drugs had been prescribed by physicians (95.8%) and for the purpose of relaxation or stress relief (73.2%). Women, medicalstudents (compared with dental students) and participants with lower academic performance were more likely to use psychoactive drugs. After the multivariate adjustment, the “course” and “academic performance” remained associated with use of psychoactive drugs.

Canine Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-c-96T	DL Develop	96T	EUR 688
Should the Canine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Von Willebrand Factor (vWF) in samples from plasma.

Human Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-Hu-48T	DL Develop	48T	EUR 479
Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Human Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-Hu-96T	DL Develop	96T	EUR 621
Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Mouse Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Mouse Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Porcine Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-p-48T	DL Develop	48T	EUR 547
Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Porcine Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-p-96T	DL Develop	96T	EUR 715
Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Rat Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Rat Von Willebrand Factor (vWF) ELISA Kit
DLR-vWF-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Canine Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-c-192	DLdevelop	1 kit of 192 tests	EUR 1180
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-c-48	DLdevelop	1 kit of 48 tests	EUR 492
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-c-96	DLdevelop	1 kit of 96 tests	EUR 660
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Hu-192	DLdevelop	1 kit of 192 tests	EUR 1054
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Hu-48	DLdevelop	1 kit of 48 tests	EUR 447
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Hu-96	DLdevelop	1 kit of 96 tests	EUR 597
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Mu-192	DLdevelop	1 kit of 192 tests	EUR 1079
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Mu-48	DLdevelop	1 kit of 48 tests	EUR 456
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Mu-96	DLdevelop	1 kit of 96 tests	EUR 609
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-p-192	DLdevelop	1 kit of 192 tests	EUR 1231
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-p-48	DLdevelop	1 kit of 48 tests	EUR 510
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-p-96	DLdevelop	1 kit of 96 tests	EUR 685
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Ra-192	DLdevelop	1 kit of 192 tests	EUR 1130
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Ra-48	DLdevelop	1 kit of 48 tests	EUR 474
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit
DL-vWF-Ra-96	DLdevelop	1 kit of 96 tests	EUR 635
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-c-48Tests	Reddot Biotech	48 Tests	EUR 533

Canine Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-c-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Porcine Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Von Willebrand Factor (vWF) ELISA Kit
RD-vWF-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Canine Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-c-48Tests	Reddot Biotech	48 Tests	EUR 557

Canine Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-c-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Porcine Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Von Willebrand Factor (vWF) ELISA Kit
RDR-vWF-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

EIA Diluent
2001-100ml	Ethos Biosciences	100 ml	EUR 282

EIA Diluent
2001-1L	Ethos Biosciences	1 Liter	EUR 1181

Cortisol EIA Kit
EK7119	BosterBio	96wells/kit	EUR 478

Cortisol EIA Kit
SKT-201-96	Stressmarq	1 plate of 96 wells	EUR 329
Cortisol, C21H30O5, (hydrocortisone, compound F) is the primary glucocorticoid produced and secreted by the adrenal cortex. It is often referred to as the ?stress hormone? as it is involved in the response to stress and it affects blood pressure, blo Show more
Description: Competitive EIA kit used for quantitative measuring cortisol present in Dried Fecal Samples, Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Corticosterone EIA Kit
SKT-205-96	Stressmarq	1 plate of 96 wells	EUR 355
Corticosterone (C21H30O4, Kendall's Compound ?B') is a glucocorticoid secreted by the cortex of the adrenal gland. Corticosterone is produced in response to stimulation of the adrenal cortex by ACTH and is the precursor of aldosterone. Corticosterone Show more
Description: Sandwich EIA kit used to measure the corticosterone present in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media, Dried Fecal Samples samples from all species

DM1 ADC EIA Kit
DEIABL311	Creative Diagnostics	96T	Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-DM1-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of DM1 Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture a

MMAE ADC EIA Kit
DEIABL312	Creative Diagnostics	96T	Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAE-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAE Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

MMAF ADC EIA Kit
DEIABL313	Creative Diagnostics	96T	Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAF-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAF Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

Prostaglandin E2 EIA Kit
SKT-207-96	Stressmarq	1 plate of 96 wells	EUR 527
Eicosanoid signal transduction pathways are highly conserved and are involved in a number of physiological processes. Prostaglandins are synthesized from arachidonic acid by cyclooxygenase (COX)-1 or -2, which convert the acid into PGH2. This is furt Show more
Description: Sandwich EIA kit used for quantitative measuring PGE2 present in Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic AMP EIA Kit
SKT-209-96	Stressmarq	1 plate of 96 wells	EUR 454
Adenosine-3',5'-cyclic monophosphate (cyclic AMP) is a second messenger that plays an important role in intracellular regulation. Specifically, it functions as a mediator of activity of several key hormones including epinephrine, glucagon, and ACTH ( Show more
Description: Direct EIA kit used for quantitative measuring cAMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic GMP EIA Kit
SKT-211-96	Stressmarq	1 plate of 96 wells	EUR 474
Guanosine 3', 5'-cyclic monophosphate (cyclic GMP cGMP) is a critical and multifunctional second messenger present at levels typically 10-100 fold lower than cAMP in most tissues. Intracellular cGMP is formed by the action of the enzyme guanylate cy Show more
Description: Direct EIA kit used for quantitative measuring cGMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Tissue Culture Media samples from all species

Cystatin C EIA Kit
SKT-219-96	Stressmarq	1 plate of 96 wells	EUR 494
Cystatin C is a non-glycosylated protein of low molecular weight (13kDa) in the cystatin superfamily. Cystatin C is produced at a constant rate in all nucleated cells, secreted from cells and thus found in detectable amounts in most body fluids (1,2) Show more
Description: Sandwich EIA kit used to measure cystatin C levels in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media samples from Human

vWF Protein
abx069979-100ug	Abbexa	100 ug	EUR 1156
Shipped within 5-10 working days.

VWF Antibody
AF3000	Affbiotech	200ul	EUR 376
Description: VWF Antibody detects endogenous levels of total VWF.

VWF Antibody
BF3001	Lifescience Market	100 ug	EUR 469

VWF Antibody
1-CSB-PA12779A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VWF Antibody
1-CSB-PA025960GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

VWF Antibody
1-CSB-PA292051	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

VWF Antibody
1-CSB-PA195869	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

VWF antibody
20C-CR6077SP	Fitzgerald	1 ml	EUR 241
Description: Sheep polyclonal VWF antibody

VWF antibody
20R-1403	Fitzgerald	5 mg	EUR 303
Description: Sheep polyclonal VWF antibody

VWF protein
30C-CP4002U	Fitzgerald	100 ug	EUR 705
Description: Purified native Human VWF protein

VWF antibody
20R-VG001	Fitzgerald	2.5 mg	EUR 225
Description: Goat polyclonal VWF antibody

VWF antibody
20R-VS001	Fitzgerald	5 mg	EUR 381
Description: Sheep polyclonal VWF antibody

VWF antibody
20R-VS002	Fitzgerald	5 mg	EUR 303
Description: Sheep polyclonal VWF antibody

VWF Antibody
39594-100ul	SAB	100ul	EUR 390

VWF Antibody
35988-100ul	SAB	100ul	EUR 252

VWF antibody
70R-21290	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal VWF antibody

vWF siRNA
20-abx939623	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

vWF siRNA
20-abx939624	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VWF antibody
70R-10589	Fitzgerald	500 ug	EUR 512
Description: Affinity purified goat polyclonal VWF antibody

EIA Wash Buffer 10x concentrate
1003-1	Ethos Biosciences	1 Liter	EUR 231

ImmunoComb Chlamydia Bivalent EIA kit
50416002	Bionote	1 kit	EUR 370.6
Description: Please check the datasheet of ImmunoComb Chlamydia Bivalent EIA kit before using the test.

Androstenedione ELISA Kit (Competitive EIA)
EK7019	BosterBio	96wells/kit, with removable strips.	EUR 688

Epiandrosterone EIA Kit (One Plate)
K063-H1	Arbor Assays	1x96 well plate	EUR 436

Epiandrosterone EIA Kit (Five Plate)
K063-H5	Arbor Assays	5x96 well plate	EUR 1545

Estriol EIA Kit (One Plate)
K064-H1	Arbor Assays	1x96 well plate	EUR 327

Estriol EIA Kit (Five Plate)
K064-H5	Arbor Assays	5x96 well plate	EUR 1110

Prolactin EIA kit (One Plate)
K040-H1	Arbor Assays	1x96 well plate	EUR 471

Allopregnanolone EIA Kit (One Plate)
K044-H1	Arbor Assays	1x96 well plate	EUR 425

Allopregnanolone EIA Kit (Five Plate)
K044-H5	Arbor Assays	5x96 well plate	EUR 1490

Insulin EIA Kit (One Plate)
K046-H1	Arbor Assays	1x96 well plate	EUR 501

Estradiol EIA kit (One Plate)
K030-H1	Arbor Assays	1x96 well plate	EUR 283

Estradiol EIA kit (Five Plates)
K030-H5	Arbor Assays	5x96 well plate	EUR 985

Estrone EIA kit (One Plate)
K031-H1	Arbor Assays	1x96 well plate	EUR 300

Estrone EIA kit (Five Plates)
K031-H5	Arbor Assays	5x96 well plate	EUR 1001

Testosterone EIA kit (One Plate)
K032-H1	Arbor Assays	1x96 well plate	EUR 316

Testosterone EIA kit (Five Plates)
K032-H5	Arbor Assays	5x96 well plate	EUR 1045

Oxytocin EIA Kit (One Plate)
K048-H1	Arbor Assays	1x96 well plate	EUR 450

Oxytocin EIA Kit (Five Plate)
K048-H5	Arbor Assays	5x96 well plate	EUR 1597

Aldosterone EIA Kit (One Plate)
K052-H1	Arbor Assays	1x96 well plate	EUR 387

Aldosterone EIA Kit (Five Plate)
K052-H5	Arbor Assays	5x96 well plate	EUR 1355

Progesterone EIA kit (One Plate)
K025-H1	Arbor Assays	1x96 well plate	EUR 305

Progesterone EIA kit (Five Plates)
K025-H5	Arbor Assays	5x96 well plate	EUR 1012

VWF Conjugated Antibody
C35988	SAB	100ul	EUR 397

VWF Blocking Peptide
AF3000-BP	Affbiotech	1mg	EUR 195

VWF cloning plasmid
CSB-CL025960HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 822 Sequence: atgggggcacaggatgaggaggaaggaatccaagacttggatggattattagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagagactgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagagggaccctttg Show more
Description: A cloning plasmid for the VWF gene.

VWF Polyclonal Antibody
A55683	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

VWF antibody (HRP)
60R-VG002hrp	Fitzgerald	150 ug	EUR 358
Description: Goat polyclonal VWF antibody (HRP) conjugated

VWF antibody (HRP)
60R-VS001hrp	Fitzgerald	200 ug	EUR 358
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF antibody (biotin)
60R-1019	Fitzgerald	100 ug	EUR 392
Description: Goat polyclonal VWF antibody (biotin) conjugated

VWF antibody (HRP)
60R-1021	Fitzgerald	200 ug	EUR 358
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF Polyclonal Antibody
ABP60910-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human VWF protein Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF Polyclonal Antibody
ABP60910-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human VWF protein Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF Polyclonal Antibody
ABP60910-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VWF protein Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF, VWFpp Antibody
abx239466-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

VWF Polyclonal Antibody
E-AB-10679-120uL	Elabscience Biotechnology	120uL	EUR 257
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Polyclonal Antibody
E-AB-10679-20uL	Elabscience Biotechnology	20uL	EUR 130
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Polyclonal Antibody
E-AB-10679-60uL	Elabscience Biotechnology	60uL	EUR 175
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Rabbit mAb
A13523-100ul	Abclonal	100 ul	EUR 410

VWF Rabbit mAb
A13523-200ul	Abclonal	200 ul	EUR 571

VWF Rabbit mAb
A13523-20ul	Abclonal	20 ul	EUR 221

VWF Rabbit mAb
A13523-50ul	Abclonal	50 ul	EUR 287

VWF: CBA ELISA
55R-1002	Fitzgerald	96 tests	EUR 909
Description: ELISA kit for the detection of von Willebrand Factor

VWF antibody (FITC)
60R-1018	Fitzgerald	100 ug	EUR 358
Description: Goat polyclonal VWF antibody (FITC) conjugated

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

VWF Polyclonal Antibody
E-AB-70006-120uL	Elabscience Biotechnology	120uL	EUR 253
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol. Purified by: Affinity purification Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody
E-AB-70006-200uL	Elabscience Biotechnology	200uL	EUR 400
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol. Purified by: Affinity purification Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody
E-AB-70006-60uL	Elabscience Biotechnology	60uL	EUR 182
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol. Purified by: Affinity purification Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody
ES10984-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC

VWF Polyclonal Antibody
ES10984-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC

Anti-VWF antibody
STJ192142	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to VWF

DetectX® Allopregnanolone EIA Antibody, 13ML
C226-13ML	Arbor Assays	13ML	EUR 1059

DetectX® Allopregnanolone EIA Antibody, 3ML
C226-3ML	Arbor Assays	3ML	EUR 298

DetectX® Epiandrosterone EIA Antibody, 13ML
C231-13ML	Arbor Assays	13ML	EUR 1044

DetectX® Epiandrosterone EIA Antibody, 3ML
C231-3ML	Arbor Assays	3ML	EUR 298

Human Chlamydia pneumoniae IgG EIA Kit
DEIA1726	Creative Diagnostics	96T	EUR 1177
Description: CD's Chlamydia pneumoniae IgG test is developed for the detection of IgG antibodies specific to Chlamydia pneumoniae in human serum or plasma. The kit is semiquantitative allowing comparison of paired samples. The change of antibody level is an aid fo

Human Chlamydia pneumoniae IgM EIA Kit
DEIA1727	Creative Diagnostics	96T	EUR 1177
Description: Chlamydia pneumoniae IgM test (DEIA1727) is developed for the detection of IgM antibodies specific to Chlamydia pneumoniae in human serum or plasma. The positive result is an aid for the diagnosis of acute Chlamydia pneumonia infection. The test

Retinol Binding Protein Serum EIA Kit
K004-H1	Arbor Assays	1x96 well plate	EUR 318

Human Cotinine ELISA Kit (Competitive EIA)
EK7035	BosterBio	96wells/kit, with removable strips.	EUR 478

Human Opiates ELISA Kit (Competitive EIA)
EK7078	BosterBio	96wells/kit, with removable strips.	EUR 478

20-Hydroxyecdysone EIA Kit (One Plate)
K066-H1	Arbor Assays	1x96 well plate	EUR 511

20-Hydroxyecdysone EIA Kit (Five Plate)
K066-H5	Arbor Assays	5x96 well plate	EUR 1953

Progesterone Metabolites EIA Kit (One Plate)
K068-H1	Arbor Assays	1x96 well plate	EUR 305

Progesterone Metabolites EIA Kit (Five Plate)
K068-H5	Arbor Assays	5x96 well plate	EUR 1012

ST2 Human EIA Kit, 1 Plate
K055-H1	Arbor Assays	1x96 well plate	EUR 593

Triiodothyronine (T3) EIA Kit (One Plate)
K056-H1	Arbor Assays	1x96 well plate	EUR 400

Triiodothyronine (T3) EIA Kit (Five Plate)
K056-H5	Arbor Assays	5x96 well plate	EUR 1394

Levonorgestrel (LNG) EIA Kit (One Plate)
K058-H1	Arbor Assays	1x96 well plate	EUR 557

Levonorgestrel (LNG) EIA Kit (Five Plate)
K058-H5	Arbor Assays	5x96 well plate	EUR 2080

DNA Damage EIA Kit (One Plate)
K059-H1	Arbor Assays	1x96 well plate	EUR 552

DNA Damage EIA Kit (Five Plate)
K059-H5	Arbor Assays	5x96 well plate	EUR 2074

Myeloperoxidase Human EIA Kit (One Plate)
K060-H1	Arbor Assays	1x96 well plate	EUR 516

Thyroxine (T4) EIA kit (One Plate)
K050-H1	Arbor Assays	1x96 well plate	EUR 400

Thyroxine (T4) EIA kit (Five Plates)
K050-H5	Arbor Assays	5x96 well plate	EUR 1394

17-Hydroxyprogesterone EIA kit (One Plate)
K053-H1	Arbor Assays	1x96 well plate	EUR 566

17-Hydroxyprogesterone EIA kit (Five Plate)
K053-H5	Arbor Assays	5x96 well plate	EUR 1980

DHEA-S EIA Kit (One Plate)
K054-H1	Arbor Assays	1x96 well plate	EUR 403

DHEA-S EIA Kit (Five Plate)
K054-H5	Arbor Assays	5x96 well plate	EUR 1436

Glucagon (human/mouse/rat) EIA Kit
K4756-100	Biovision		EUR 843

Obestatin (human/mouse/rat) EIA Kit
K4759-100	Biovision	100 assays	EUR 789
Kit components:
Description: Sensitive, Colorimetric Assay

Resistin (human/mouse/rat) EIA Kit
K4767-100	Biovision	100 assays	EUR 789
Kit components: Resistin Microplate (Item A) coated with secondary antibody, 96 wells Wash Buffer Concentrate (20x) (Item B) Standard Resistin Peptide (Item C) (10 μl/vial) Anti-Resistin polyclonal antibody (item N) (5 μl/vial) Assay Show more
Description: Sensitive, Colorimetric Assay

Ghrelin (human, mouse, rat) EIA Kit
K4790-100	Biovision	100 assays	EUR 789
Kit components: Ghrelin Microplate (Item A) coated with secondary antibody, 96 wells Wash Buffer Concentrate (20x) (Item B) Lyophilized Standard Ghrelin Peptide (Item C) Lyophilized anti-Ghrelin Polyclonal antibody (Item N) 1 X Assay Dilue Show more
Description: Sensitive, Colorimetric Assay

Estradiol Serum EIA kit (One Plate)
KB30-H1	Arbor Assays	1x96 well plate	EUR 359

Estradiol Serum EIA kit (Five Plates)
KB30-H5	Arbor Assays	5x96 well plate	EUR 1246

Retinol Binding Protein Urinary EIA Kit
SKT-218-96	Stressmarq	1 plate of 96 wells	EUR 527
Retinol binding protein (RBP) is from a family of structurally related proteins that bind small hydrophobic molecules such as bile pigments, steroids, odorants, etc (1). RBP is a 21 kDa highly conserved, single-chain glycoprotein, consisting of 182 a Show more
Description: Sandwich EIA kit used to measure RBP levels in urine samples in Urine samples from Human, Rat, Dog, Monkey

VWF Antibody, HRP conjugated
1-CSB-PA12779B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VWF Antibody, FITC conjugated
1-CSB-PA12779C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VWF Antibody, Biotin conjugated
1-CSB-PA12779D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human VWF shRNA Plasmid
20-abx955097	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse VWF shRNA Plasmid
20-abx973382	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human VWF ELISA Kit
ELA-E0833h	Lifescience Market	96 Tests	EUR 824

Human Vwf ELISA Kit
EHV0008	Abclonal	96Tests	EUR 521

Human VWF ELISA Kit
EHV0053	Abclonal	96Tests	EUR 521

Chicken Vwf ELISA Kit
ECKV0008	Abclonal	96Tests	EUR 521

Canine Vwf ELISA Kit
ECV0008	Abclonal	96Tests	EUR 521

Canine VWF ELISA Kit
ECV0053	Abclonal	96Tests	EUR 521

VWF ELISA KIT|Human
EF001680	Lifescience Market	96 Tests	EUR 689

Anserini Vwf ELISA Kit
EAV0008	Abclonal	96Tests	EUR 521

Anserini VWF ELISA Kit
EAV0053	Abclonal	96Tests	EUR 521

Bovine Vwf ELISA Kit
EBV0008	Abclonal	96Tests	EUR 521

Bovine VWF ELISA Kit
EBV0053	Abclonal	96Tests	EUR 521

Porcine Vwf ELISA Kit
EPV0008	Abclonal	96Tests	EUR 521

Porcine VWF ELISA Kit
EPV0053	Abclonal	96Tests	EUR 521

Rabbit Vwf ELISA Kit
ERTV0008	Abclonal	96Tests	EUR 521

Rabbit VWF ELISA Kit
ERTV0053	Abclonal	96Tests	EUR 521

Rat Vwf ELISA Kit
ERV0008	Abclonal	96Tests	EUR 521

Rat VWF ELISA Kit
ERV0053	Abclonal	96Tests	EUR 521

Monkey Vwf ELISA Kit
EMKV0008	Abclonal	96Tests	EUR 521

Mouse Vwf ELISA Kit
EMV0008	Abclonal	96Tests	EUR 521

Mouse VWF ELISA Kit
EMV0053	Abclonal	96Tests	EUR 521

Goat Vwf ELISA Kit
EGTV0008	Abclonal	96Tests	EUR 521

Goat VWF ELISA Kit
EGTV0053	Abclonal	96Tests	EUR 521

There was high prevalence of psychoactive drug use among the students at the higher education institution investigated. Some variables (female sex, medicalstudents and low academic performance) were associated with the outcome.