Academic performance and use of psychoactive drugs among healthcare students at a university in southern Brazil: cross-sectional study.

People have been using psychoactive substances for a long time. Over the last few years, this practice has spread among university students, who use these substances to improve their academic performance, relieve stress and increase concentration and memory.

To estimate the use of psychoactive drugs among healthcare students at a higher education institution in the city of Passo Fundo (RS), Brazil, and to ascertain the associated demographic and lifestyle factors.Cross-sectional study in a higher education institution.We included 287 undergraduate medicine and dentistry students in this study.

They answered a self-administered questionnaire regarding sociodemographic, lifestyle and health variables. The statistical analysis used univariate and bivariate analyses with Pearson’s chi-square test (P-value < 0.05). -Multivariate analyses were used to estimate odds ratios (OR) and their respective 95% confidence intervals. The SPSS software, version 20.0, was used.The prevalence of use of psychoactive substances among the students was 24.7%.

Among these students, high frequencies of psychoactive drugs had been prescribed by physicians (95.8%) and for the purpose of relaxation or stress relief (73.2%). Women, medicalstudents (compared with dental students) and participants with lower academic performance were more likely to use psychoactive drugs. After the multivariate adjustment, the “course” and “academic performance” remained associated with use of psychoactive drugs.

Canine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-c-96T 96T
EUR 688
  • Should the Canine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Von Willebrand Factor (vWF) in samples from plasma.

Human Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Hu-48T 48T
EUR 479
  • Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Human Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Hu-96T 96T
EUR 621
  • Should the Human Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Mouse Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Mu-48T 48T
EUR 489
  • Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Mouse Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Mu-96T 96T
EUR 635
  • Should the Mouse Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Von Willebrand Factor (vWF) in samples from plasma.

Porcine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-p-48T 48T
EUR 547
  • Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Porcine Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-p-96T 96T
EUR 715
  • Should the Porcine Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Porcine Von Willebrand Factor (vWF) in samples from plasma or other biological fluids.

Rat Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Ra-48T 48T
EUR 508
  • Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Rat Von Willebrand Factor (vWF) ELISA Kit

DLR-vWF-Ra-96T 96T
EUR 661
  • Should the Rat Von Willebrand Factor (vWF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Von Willebrand Factor (vWF) in samples from plasma.

Canine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-c-192 1 kit of 192 tests
EUR 1180
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-c-48 1 kit of 48 tests
EUR 492
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-c-96 1 kit of 96 tests
EUR 660
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Hu-192 1 kit of 192 tests
EUR 1054
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Hu-48 1 kit of 48 tests
EUR 447
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Human Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Hu-96 1 kit of 96 tests
EUR 597
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Mu-192 1 kit of 192 tests
EUR 1079
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Mu-48 1 kit of 48 tests
EUR 456
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Mouse Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Mu-96 1 kit of 96 tests
EUR 609
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Mouse Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-p-192 1 kit of 192 tests
EUR 1231
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-p-48 1 kit of 48 tests
EUR 510
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Porcine Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-p-96 1 kit of 96 tests
EUR 685
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Porcine Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Ra-192 1 kit of 192 tests
EUR 1130
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Ra-48 1 kit of 48 tests
EUR 474
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Rat Von Willebrand Factor (vWF) ELISA Kit

DL-vWF-Ra-96 1 kit of 96 tests
EUR 635
Description: An ELISA kit based on the competitive inhibition method for detection and quantification of Rat Von Willebrand Factor (vWF)

Canine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-c-48Tests 48 Tests
EUR 533

Canine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-c-96Tests 96 Tests
EUR 740

Human Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Hu-48Tests 48 Tests
EUR 478

Human Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Hu-96Tests 96 Tests
EUR 662

Mouse Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Mu-48Tests 48 Tests
EUR 489

Mouse Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Mu-96Tests 96 Tests
EUR 677

Porcine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-p-48Tests 48 Tests
EUR 555

Porcine Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-p-96Tests 96 Tests
EUR 771

Rat Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Ra-48Tests 48 Tests
EUR 511

Rat Von Willebrand Factor (vWF) ELISA Kit

RD-vWF-Ra-96Tests 96 Tests
EUR 709

Canine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-c-48Tests 48 Tests
EUR 557

Canine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-c-96Tests 96 Tests
EUR 774

Human Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Hu-48Tests 48 Tests
EUR 500

Human Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Hu-96Tests 96 Tests
EUR 692

Mouse Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Mu-48Tests 48 Tests
EUR 511

Mouse Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Mu-96Tests 96 Tests
EUR 709

Porcine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-p-48Tests 48 Tests
EUR 580

Porcine Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-p-96Tests 96 Tests
EUR 807

Rat Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Ra-48Tests 48 Tests
EUR 534

Rat Von Willebrand Factor (vWF) ELISA Kit

RDR-vWF-Ra-96Tests 96 Tests
EUR 742

EIA Diluent

2001-100ml 100 ml
EUR 282

EIA Diluent

2001-1L 1 Liter
EUR 1181

Cortisol EIA Kit

EK7119 96wells/kit
EUR 478

Cortisol EIA Kit

SKT-201-96 1 plate of 96 wells
EUR 329
  • Cortisol, C21H30O5, (hydrocortisone, compound F) is the primary glucocorticoid produced and secreted by the adrenal cortex. It is often referred to as the ?stress hormone? as it is involved in the response to stress and it affects blood pressure, blo
  • Show more
Description: Competitive EIA kit used for quantitative measuring cortisol present in Dried Fecal Samples, Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Corticosterone EIA Kit

SKT-205-96 1 plate of 96 wells
EUR 355
  • Corticosterone (C21H30O4, Kendall's Compound ?B') is a glucocorticoid secreted by the cortex of the adrenal gland. Corticosterone is produced in response to stimulation of the adrenal cortex by ACTH and is the precursor of aldosterone. Corticosterone
  • Show more
Description: Sandwich EIA kit used to measure the corticosterone present in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media, Dried Fecal Samples samples from all species

DM1 ADC EIA Kit

DEIABL311 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-DM1-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of DM1 Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture a

MMAE ADC EIA Kit

DEIABL312 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAE-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAE Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

MMAF ADC EIA Kit

DEIABL313 96T Ask for price
Description: This test kit is intended for use in the quantitative determination of antibody-MMAF-conjugate level in test sample. It is useful for preclinical and clinical pharmacology study of MMAF Antibody Drug Conjugate (ADC). - Samples from tissue/cell culture

Prostaglandin E2 EIA Kit

SKT-207-96 1 plate of 96 wells
EUR 527
  • Eicosanoid signal transduction pathways are highly conserved and are involved in a number of physiological processes. Prostaglandins are synthesized from arachidonic acid by cyclooxygenase (COX)-1 or -2, which convert the acid into PGH2. This is furt
  • Show more
Description: Sandwich EIA kit used for quantitative measuring PGE2 present in Saliva, Urine, Serum, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic AMP EIA Kit

SKT-209-96 1 plate of 96 wells
EUR 454
  • Adenosine-3',5'-cyclic monophosphate (cyclic AMP) is a second messenger that plays an important role in intracellular regulation. Specifically, it functions as a mediator of activity of several key hormones including epinephrine, glucagon, and ACTH (
  • Show more
Description: Direct EIA kit used for quantitative measuring cAMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Heparin Plasma, Tissue Culture Media samples from all species

Cyclic GMP EIA Kit

SKT-211-96 1 plate of 96 wells
EUR 474
  • Guanosine 3', 5'-cyclic monophosphate (cyclic GMP
  • cGMP) is a critical and multifunctional second messenger present at levels typically 10-100 fold lower than cAMP in most tissues. Intracellular cGMP is formed by the action of the enzyme guanylate cy
  • Show more
Description: Direct EIA kit used for quantitative measuring cGMP present in Cell Lysates, Tissue, Saliva, Urine, EDTA Plasma, Tissue Culture Media samples from all species

Cystatin C EIA Kit

SKT-219-96 1 plate of 96 wells
EUR 494
  • Cystatin C is a non-glycosylated protein of low molecular weight (13kDa) in the cystatin superfamily. Cystatin C is produced at a constant rate in all nucleated cells, secreted from cells and thus found in detectable amounts in most body fluids (1,2)
  • Show more
Description: Sandwich EIA kit used to measure cystatin C levels in Serum, EDTA Plasma, Heparin Plasma, Urine, Tissue Culture Media samples from Human

vWF Protein

abx069979-100ug 100 ug
EUR 1156
  • Shipped within 5-10 working days.

VWF Antibody

AF3000 200ul
EUR 376
Description: VWF Antibody detects endogenous levels of total VWF.

VWF Antibody

BF3001 100 ug
EUR 469

VWF Antibody

1-CSB-PA12779A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VWF Antibody

1-CSB-PA025960GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

VWF Antibody

1-CSB-PA292051
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

VWF Antibody

1-CSB-PA195869
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

VWF antibody

20C-CR6077SP 1 ml
EUR 241
Description: Sheep polyclonal VWF antibody

VWF antibody

20R-1403 5 mg
EUR 303
Description: Sheep polyclonal VWF antibody

VWF protein

30C-CP4002U 100 ug
EUR 705
Description: Purified native Human VWF protein

VWF antibody

20R-VG001 2.5 mg
EUR 225
Description: Goat polyclonal VWF antibody

VWF antibody

20R-VS001 5 mg
EUR 381
Description: Sheep polyclonal VWF antibody

VWF antibody

20R-VS002 5 mg
EUR 303
Description: Sheep polyclonal VWF antibody

VWF Antibody

39594-100ul 100ul
EUR 390

VWF Antibody

35988-100ul 100ul
EUR 252

VWF antibody

70R-21290 50 ul
EUR 435
Description: Rabbit polyclonal VWF antibody

vWF siRNA

20-abx939623
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

vWF siRNA

20-abx939624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VWF antibody

70R-10589 500 ug
EUR 512
Description: Affinity purified goat polyclonal VWF antibody

EIA Wash Buffer 10x concentrate

1003-1 1 Liter
EUR 231

ImmunoComb Chlamydia Bivalent EIA kit

50416002 1 kit
EUR 370.6
Description: Please check the datasheet of ImmunoComb Chlamydia Bivalent EIA kit before using the test.

Androstenedione ELISA Kit (Competitive EIA)

EK7019 96wells/kit, with removable strips.
EUR 688

Epiandrosterone EIA Kit (One Plate)

K063-H1 1x96 well plate
EUR 436

Epiandrosterone EIA Kit (Five Plate)

K063-H5 5x96 well plate
EUR 1545

Estriol EIA Kit (One Plate)

K064-H1 1x96 well plate
EUR 327

Estriol EIA Kit (Five Plate)

K064-H5 5x96 well plate
EUR 1110

Prolactin EIA kit (One Plate)

K040-H1 1x96 well plate
EUR 471

Allopregnanolone EIA Kit (One Plate)

K044-H1 1x96 well plate
EUR 425

Allopregnanolone EIA Kit (Five Plate)

K044-H5 5x96 well plate
EUR 1490

Insulin EIA Kit (One Plate)

K046-H1 1x96 well plate
EUR 501

Estradiol EIA kit (One Plate)

K030-H1 1x96 well plate
EUR 283

Estradiol EIA kit (Five Plates)

K030-H5 5x96 well plate
EUR 985

Estrone EIA kit (One Plate)

K031-H1 1x96 well plate
EUR 300

Estrone EIA kit (Five Plates)

K031-H5 5x96 well plate
EUR 1001

Testosterone EIA kit (One Plate)

K032-H1 1x96 well plate
EUR 316

Testosterone EIA kit (Five Plates)

K032-H5 5x96 well plate
EUR 1045

Oxytocin EIA Kit (One Plate)

K048-H1 1x96 well plate
EUR 450

Oxytocin EIA Kit (Five Plate)

K048-H5 5x96 well plate
EUR 1597

Aldosterone EIA Kit (One Plate)

K052-H1 1x96 well plate
EUR 387

Aldosterone EIA Kit (Five Plate)

K052-H5 5x96 well plate
EUR 1355

Progesterone EIA kit (One Plate)

K025-H1 1x96 well plate
EUR 305

Progesterone EIA kit (Five Plates)

K025-H5 5x96 well plate
EUR 1012

VWF Conjugated Antibody

C35988 100ul
EUR 397

VWF Blocking Peptide

AF3000-BP 1mg
EUR 195

VWF cloning plasmid

CSB-CL025960HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgggggcacaggatgaggaggaaggaatccaagacttggatggattattagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagagactgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagagggaccctttg
  • Show more
Description: A cloning plasmid for the VWF gene.

VWF Polyclonal Antibody

A55683 100 µg
EUR 570.55
Description: reagents widely cited

VWF antibody (HRP)

60R-VG002hrp 150 ug
EUR 358
Description: Goat polyclonal VWF antibody (HRP) conjugated

VWF antibody (HRP)

60R-VS001hrp 200 ug
EUR 358
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF antibody (biotin)

60R-1019 100 ug
EUR 392
Description: Goat polyclonal VWF antibody (biotin) conjugated

VWF antibody (HRP)

60R-1021 200 ug
EUR 358
Description: Sheep polyclonal VWF antibody (HRP) conjugated

VWF Polyclonal Antibody

ABP60910-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VWF protein
  • Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF Polyclonal Antibody

ABP60910-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VWF protein
  • Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF Polyclonal Antibody

ABP60910-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VWF protein
  • Applications tips:
Description: A polyclonal antibody for detection of VWF from Human, Mouse, Rat. This VWF antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VWF protein

VWF, VWFpp Antibody

abx239466-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

VWF Polyclonal Antibody

E-AB-10679-120uL 120uL
EUR 257
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v
  • Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Polyclonal Antibody

E-AB-10679-20uL 20uL
EUR 130
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v
  • Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Polyclonal Antibody

E-AB-10679-60uL 60uL
EUR 175
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-v
  • Show more
Description: Rabbit antibody against Human VWF for IHC,ELISA applications.

VWF Rabbit mAb

A13523-100ul 100 ul
EUR 410

VWF Rabbit mAb

A13523-200ul 200 ul
EUR 571

VWF Rabbit mAb

A13523-20ul 20 ul
EUR 221

VWF Rabbit mAb

A13523-50ul 50 ul
EUR 287

VWF: CBA ELISA

55R-1002 96 tests
EUR 909
Description: ELISA kit for the detection of von Willebrand Factor

VWF antibody (FITC)

60R-1018 100 ug
EUR 358
Description: Goat polyclonal VWF antibody (FITC) conjugated

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

VWF Polyclonal Antibody

E-AB-70006-120uL 120uL
EUR 253
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody

E-AB-70006-200uL 200uL
EUR 400
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody

E-AB-70006-60uL 60uL
EUR 182
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier an
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat VWF for IHC applications.

VWF Polyclonal Antibody

ES10984-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC

VWF Polyclonal Antibody

ES10984-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VWF from Human/Mouse/Rat. This antibody is tested and validated for IHC

Anti-VWF antibody

STJ192142 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VWF

DetectX® Allopregnanolone EIA Antibody, 13ML

C226-13ML 13ML
EUR 1059

DetectX® Allopregnanolone EIA Antibody, 3ML

C226-3ML 3ML
EUR 298

DetectX® Epiandrosterone EIA Antibody, 13ML

C231-13ML 13ML
EUR 1044

DetectX® Epiandrosterone EIA Antibody, 3ML

C231-3ML 3ML
EUR 298

Human Chlamydia pneumoniae IgG EIA Kit

DEIA1726 96T
EUR 1177
Description: CD's Chlamydia pneumoniae IgG test is developed for the detection of IgG antibodies specific to Chlamydia pneumoniae in human serum or plasma. The kit is semiquantitative allowing comparison of paired samples. The change of antibody level is an aid fo

Human Chlamydia pneumoniae IgM EIA Kit

DEIA1727 96T
EUR 1177
Description: Chlamydia pneumoniae IgM test (DEIA1727) is developed for the detection of IgM antibodies specific to Chlamydia pneumoniae in human serum or plasma. The positive result is an aid for the diagnosis of acute Chlamydia pneumonia infection. The test

Retinol Binding Protein Serum EIA Kit

K004-H1 1x96 well plate
EUR 318

Human Cotinine ELISA Kit (Competitive EIA)

EK7035 96wells/kit, with removable strips.
EUR 478

Human Opiates ELISA Kit (Competitive EIA)

EK7078 96wells/kit, with removable strips.
EUR 478

20-Hydroxyecdysone EIA Kit (One Plate)

K066-H1 1x96 well plate
EUR 511

20-Hydroxyecdysone EIA Kit (Five Plate)

K066-H5 5x96 well plate
EUR 1953

Progesterone Metabolites EIA Kit (One Plate)

K068-H1 1x96 well plate
EUR 305

Progesterone Metabolites EIA Kit (Five Plate)

K068-H5 5x96 well plate
EUR 1012

ST2 Human EIA Kit, 1 Plate

K055-H1 1x96 well plate
EUR 593

Triiodothyronine (T3) EIA Kit (One Plate)

K056-H1 1x96 well plate
EUR 400

Triiodothyronine (T3) EIA Kit (Five Plate)

K056-H5 5x96 well plate
EUR 1394

Levonorgestrel (LNG) EIA Kit (One Plate)

K058-H1 1x96 well plate
EUR 557

Levonorgestrel (LNG) EIA Kit (Five Plate)

K058-H5 5x96 well plate
EUR 2080

DNA Damage EIA Kit (One Plate)

K059-H1 1x96 well plate
EUR 552

DNA Damage EIA Kit (Five Plate)

K059-H5 5x96 well plate
EUR 2074

Myeloperoxidase Human EIA Kit (One Plate)

K060-H1 1x96 well plate
EUR 516

Thyroxine (T4) EIA kit (One Plate)

K050-H1 1x96 well plate
EUR 400

Thyroxine (T4) EIA kit (Five Plates)

K050-H5 5x96 well plate
EUR 1394

17-Hydroxyprogesterone EIA kit (One Plate)

K053-H1 1x96 well plate
EUR 566

17-Hydroxyprogesterone EIA kit (Five Plate)

K053-H5 5x96 well plate
EUR 1980

DHEA-S EIA Kit (One Plate)

K054-H1 1x96 well plate
EUR 403

DHEA-S EIA Kit (Five Plate)

K054-H5 5x96 well plate
EUR 1436

Glucagon (human/mouse/rat) EIA Kit

K4756-100
EUR 843

Obestatin (human/mouse/rat) EIA Kit

K4759-100 100 assays
EUR 789
  • Kit components:
Description: Sensitive, Colorimetric Assay

Resistin (human/mouse/rat) EIA Kit

K4767-100 100 assays
EUR 789
  • Kit components:
  • Resistin Microplate (Item A) coated with secondary antibody, 96 wells
  • Wash Buffer Concentrate (20x) (Item B)
  • Standard Resistin Peptide (Item C) (10 μl/vial)
  • Anti-Resistin polyclonal antibody (item N) (5 μl/vial)
  • Assay
  • Show more
Description: Sensitive, Colorimetric Assay

Ghrelin (human, mouse, rat) EIA Kit

K4790-100 100 assays
EUR 789
  • Kit components:
  • Ghrelin Microplate (Item A) coated with secondary antibody, 96 wells
  • Wash Buffer Concentrate (20x) (Item B)
  • Lyophilized Standard Ghrelin Peptide (Item C)
  • Lyophilized anti-Ghrelin Polyclonal antibody (Item N)
  • 1 X Assay Dilue
  • Show more
Description: Sensitive, Colorimetric Assay

Estradiol Serum EIA kit (One Plate)

KB30-H1 1x96 well plate
EUR 359

Estradiol Serum EIA kit (Five Plates)

KB30-H5 5x96 well plate
EUR 1246

Retinol Binding Protein Urinary EIA Kit

SKT-218-96 1 plate of 96 wells
EUR 527
  • Retinol binding protein (RBP) is from a family of structurally related proteins that bind small hydrophobic molecules such as bile pigments, steroids, odorants, etc (1). RBP is a 21 kDa highly conserved, single-chain glycoprotein, consisting of 182 a
  • Show more
Description: Sandwich EIA kit used to measure RBP levels in urine samples in Urine samples from Human, Rat, Dog, Monkey

VWF Antibody, HRP conjugated

1-CSB-PA12779B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VWF Antibody, FITC conjugated

1-CSB-PA12779C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VWF Antibody, Biotin conjugated

1-CSB-PA12779D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VWF. Recognizes VWF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human VWF shRNA Plasmid

20-abx955097
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse VWF shRNA Plasmid

20-abx973382
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VWF ELISA Kit

ELA-E0833h 96 Tests
EUR 824

Human Vwf ELISA Kit

EHV0008 96Tests
EUR 521

Human VWF ELISA Kit

EHV0053 96Tests
EUR 521

Chicken Vwf ELISA Kit

ECKV0008 96Tests
EUR 521

Canine Vwf ELISA Kit

ECV0008 96Tests
EUR 521

Canine VWF ELISA Kit

ECV0053 96Tests
EUR 521

VWF ELISA KIT|Human

EF001680 96 Tests
EUR 689

Anserini Vwf ELISA Kit

EAV0008 96Tests
EUR 521

Anserini VWF ELISA Kit

EAV0053 96Tests
EUR 521

Bovine Vwf ELISA Kit

EBV0008 96Tests
EUR 521

Bovine VWF ELISA Kit

EBV0053 96Tests
EUR 521

Porcine Vwf ELISA Kit

EPV0008 96Tests
EUR 521

Porcine VWF ELISA Kit

EPV0053 96Tests
EUR 521

Rabbit Vwf ELISA Kit

ERTV0008 96Tests
EUR 521

Rabbit VWF ELISA Kit

ERTV0053 96Tests
EUR 521

Rat Vwf ELISA Kit

ERV0008 96Tests
EUR 521

Rat VWF ELISA Kit

ERV0053 96Tests
EUR 521

Monkey Vwf ELISA Kit

EMKV0008 96Tests
EUR 521

Mouse Vwf ELISA Kit

EMV0008 96Tests
EUR 521

Mouse VWF ELISA Kit

EMV0053 96Tests
EUR 521

Goat Vwf ELISA Kit

EGTV0008 96Tests
EUR 521

Goat VWF ELISA Kit

EGTV0053 96Tests
EUR 521

There was high prevalence of psychoactive drug use among the students at the higher education institution investigated. Some variables (female sex, medicalstudents and low academic performance) were associated with the outcome.